|
|
(One intermediate revision by one other user not shown) |
Line 1: |
Line 1: |
| Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2. Written by
| |
| Rebecca Devine, Matt Hutchings’ Laboratory, University of East Anglia, UK
| |
|
| |
|
| <strong>Overview (see following pages for more detail)</strong>
| |
|
| |
| 1. Design flanking primers and gRNA
| |
|
| |
| 2. Optimise primer conditions using gradient PCR on flanking primers using WT gDNA
| |
|
| |
| 3. Anneal gRNA using oligo spacer programme
| |
|
| |
| 4. Golden gate assembly of annealed gRNA into plasmid
| |
|
| |
| 5. Transform into E. coli using heat shock
| |
|
| |
| 6. Select for successful transformants using blue/white selection and Xgal
| |
|
| |
| 7. Recover plasmid by miniprep
| |
|
| |
| 8. Amplify up flanks using gDNA and optimised primer conditions
| |
|
| |
| 9. Gel extract flanks
| |
|
| |
| 10. Linearize pCRISPomyces-2 vector + gRNA generated above using XbaI digestion
| |
|
| |
| 11. Gel purify vector
| |
|
| |
| 12. Gibson Assembly of flanks into digested vector
| |
|
| |
| 13. Transform into chemically competent E. coli NEB DH5alpha cells
| |
|
| |
| 14. Grow cells on LB + Apr plates to select for transformants
| |
|
| |
| 15. Confirm transformation using colony PCR (or XbaI digestion of plasmid prep)
| |
|
| |
| 16. Extract plasmid DNA from successful colony(s) by plasmid prep
| |
|
| |
| 17. Transform finished construct into ET cells using electroporation
| |
|
| |
| 18. Conjugate ET into Streptomyces and antibiotic treat to select for ex-conjugants
| |
|
| |
|
| |
| <strong>Designing flanking primers</strong>
| |
|
| |
| 1. Find gene sequence
| |
|
| |
| 2. Keep start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC)
| |
|
| |
| 3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC
| |
|
| |
| 4. Design ~20NT external flanking primers with 60-70% GC and ~68°C Tm
| |
|
| |
| 5. Insert XbaI and gibson overlap sequence on end (not essential but increases efficiency of Gibson assembly and allows templates to be digested out/cloned back in)
| |
|
| |
| <strong>Designing gRNA</strong>
| |
|
| |
| 1. Open new copy of gene sequence
| |
|
| |
| 2. Look at REVERSE STRAND
| |
|
| |
| 3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes)
| |
|
| |
| 4. Design ~20 NT gRNA with a Tm > 60°C
| |
|
| |
| 5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against full genome to check gRNA specificity. More important to not have matching on 3’ end
| |
|
| |
| 6. Add BbsI cut site sticky ends for golden gate assembly
| |
|
| |
| <strong>Anneal gRNA using oligo spacer programme</strong>
| |
|
| |
| 1. Mix 5 μl Forward gRNA and 5 μl Reverse gRNA with 90 μl HEPES buffer
| |
|
| |
| 2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme
| |
|
| |
| <strong>Golden gate assembly of annealed gRNA into pCRISP plasmid</strong>
| |
|
| |
| 1. Set up 20 μl reactions with:
| |
|
| |
| • 100 ng backbone
| |
|
| |
| • 0.3 μl gRNA
| |
|
| |
| • 2 μl T4 ligase buffer (NEB)
| |
|
| |
| • 1 μl T4 ligase (NEB)
| |
|
| |
| • 1 μl BbsI (NEB)
| |
|
| |
| • dH2O
| |
|
| |
| 2. Incubate using golden gate programme (as below)
| |
|
| |
| • 10 cycles of the following:
| |
|
| |
| • 10 minutes at 37°C
| |
|
| |
| • 10 minutes at 16°C
| |
|
| |
| • 5 minutes at 50°C
| |
|
| |
| • 20 minutes at 65°C
| |
|
| |
| • 4°C hold
| |
|
| |
| <strong>Transform Golden Gate plasmid into E. coli using heat shock</strong>
| |
|
| |
| 1. Thaw chemically competent NEB5/Top10 cells on ice
| |
| 2. Transfer 50 μl of competent cells to a 1.5 ml microcentrifuge tube
| |
| 3. Add 2 μl assembled vector and mix gently (tip mix, DO NOT VORTEX!!)
| |
| 4. Incubate on ice for 30 minutes (DO NOT MIX!!)
| |
| 5. Heat shock cells at 42°C for 30 seconds
| |
| 6. Transfer tubes on ice for 2 minutes
| |
| 7. Add 950 μl SOC media and incubate at 37°C for 1 hour at 250 rpm to allow recovery
| |
| 8. Plate onto pre-warmed LB + Apramycin + X-gal plates and incubate at 37°C overnight
| |
| Select for successful transformants using blue/white selection
| |
| 1. Pick white colonies and grow overnight in 10 ml LB + Apramycin
| |
| Extract DNA from successful colony(s) (plasmid prep)
| |
| 2. Grow up successful colonies in LB at 37°C overnight
| |
| 3. Recover plasmid using the QIAprep Spin Miniprep kit (Qiagen)
| |
| 4. Pellet ~3 ml cells by centrifugation
| |
| 5. Resuspend cells in 250 μl Buffer P1 and 250 μl Buffer P2
| |
| 6. After 2-3 minutes of lysis reaction add Buffer N3 and centrifuge samples at 13000 rpm for 10 minutes
| |
| 7. Apply supernatant to a BLUE QIAprep spin column and centrifuge for 30 seconds
| |
| 8. Wash the column with 0.75 ml Buffer PE
| |
| 9. Discard the flow through and elute plasmid DNA in 50 μl dH2O
| |
| 10. Quantify using Nanodrop and take note of concentration for use in golden gate reaction
| |
| Linearize gRNA vector using XbaI digestion
| |
| 1. Incubate or 1 μg vector with 1 μl XbaI, 5 μl buffer H and 40 μl dH2O at 37°C for approximately 2 hours
| |
| 2. Dephosphorylate with shrimp alkaline phosphatase
| |
| 3. Run product on a gel against undigested vector and visualise using UV
| |
| 4. Excise band using a scalpel and extract DNA using the QIAquick gel extraction kit
| |
| Gibson Assembly of flanks into digested vector
| |
| 1. PCR Amplify flanking DNA using Q5 (high fidelity – less errors, good for cloning)
| |
| 2. Gel purify using Qiagen kit
| |
| 3. Incubate digested vector with 2x flanks (aim for roughly 3:1 vector:insert) and 10 μl Gibson Assembly master mix (NEB) at 50°C for at least 15 minutes (longer gives better efficiency – I usually leave it for 1 hour)
| |
| Transform into chemically competent E. coli using heat shock (see above)
| |
| Confirm transformation using colony PCR
| |
| 1. ******Conduct in STERILE conditions!!******
| |
| 2. Take ~8 1.5 ml microcentrifuge tubes (less if fewer colonies) and fill with ~500 ml LB
| |
| 3. Make up Biotaq Red master mix with 1% v/v primer
| |
| 4. Using a p10 tip, pick colony and touch tip to empty PCR tube before discarding into LB tube
| |
| 5. Add 10 μl master mix to each PCR tube and amplify (55°C for pCRISP-2 test primers)
| |
| 6. Run products on gel to see insert
| |
| 7. Innoculate successful colonies in 10 ml LB (using 500 ml LB plus tip)
| |
| Recover plasmid
| |
| …..by same method as previously
| |
| Transform finished cosmid into ET cells using electroporation
| |
| 1. Streptomyces strains contain a methyl-sensing restriction system therefore disrupted cosmids must initially be passaged through a non-methylating E. coli strain
| |
| 2. Thaw ET cells on ice
| |
| 3. Cool cuvette
| |
| 4. Take to electroporation machine – set to Bacteria, EC2 (up)
| |
| 5. Put 1 μl cosmid DNA into 50 μl of electrocompetent ET12567 cells containing the driver plasmid pUZ8002 and “pulse”
| |
| 6. Take care not to hold the metal parts of the cuvette to warm it up
| |
| 7. Reading should be around 5.4
| |
| 8. Add 900 μl LB and pipette tip mix
| |
| 9. Transfer to microcentrifuge
| |
| 10. Grow up for 1 hour to recover
| |
| 11. Plate onto LB agar containing kanamycin, apramycin and chloramphenicol to select for the incoming cosmid
| |
| 12. Incubate plates at 37ºC overnight
| |
| 13. Pick colonies, grow overnight in liquid culture and use for conjugation and glycerol stock
| |
|
| |
| Conjugate ET into KY5 and antibiotic treat to select for ex-conjugants
| |
| 1. Grow E. coli colonies selected from transformation plates in 10 ml LB broth plus Kanamycin, Chloramphenicol and Apramycin at 37°C overnight rotating at 250 rpm
| |
| 2. Sub-culture E. coli under the same conditions for approximately 4 hours the following day
| |
| 3. Once sub-cultures have reached OD600 0.6-0.8, wash the cells twice in LB to remove antibiotics that might inhibit the Streptomyces by spinning at 4000 rpm for 5 minutes.
| |
| 4. Pre-germinate Streptomyces spores in 2YT at 50 C for 10 minutes, leave to cool
| |
| 5. Combine cells, centrifuge and resuspended in 200 ul LB
| |
| 6. Plate dilutions of approx. 200 ul onto SFM agar + MgCl2 and incubated at 30°C for 16-20 hours (I increase the time for CRISPR conjugations compared to other vectors e.g. integrative plasmids i.e. use 20 hours rather than 16)
| |
| 7. Overlay with 1 ml of dH2O + 0.5 mg Nalidixic acid + 1.25 mg Apramycin to selectively kill the E. coli
| |
| 8. Return plates to the incubator at 30°C for four days or until colonies appeared (Often takes longer for CRISPR ex-conjugants to appear compared to other vectors e.g. integrative plasmids i.e. if normally takes 3-4 days expect to leave plates for 5-6 days AT LEAST!)
| |