ActinoBase - User contributions [en-gb]

Rhodococcus erythropolis

2020-08-18T09:02:57Z

Alicia: /* Growth & Maintenance */

==Organism Page==

=== ''Rhodococcus erythropolis'' ===

===Background===

===Growth & Maintenance===

[[GYM]] or [[LB]]

=====Sporulation=====

Nonsporulating

===Strains===

===Links===
=====Genomes=====
=====Transcriptomes=====
=====Proteomics=====
=====Protocols=====
====Availability====
=====Culture Collections=====

Rhodococcus erythropolis

2020-08-18T09:02:41Z

Alicia: /* Strains */

==Organism Page==

=== ''Rhodococcus erythropolis'' ===

===Background===

===Growth & Maintenance===

[[GYM]]

=====Sporulation=====

Nonsporulating

===Strains===

===Links===
=====Genomes=====
=====Transcriptomes=====
=====Proteomics=====
=====Protocols=====
====Availability====
=====Culture Collections=====

Rhodococcus erythropolis

2020-08-18T09:01:43Z

Alicia: /* Culture Collections */

==Organism Page==

=== ''Rhodococcus erythropolis'' ===

===Background===

===Growth & Maintenance===

[[GYM]]

=====Sporulation=====

Nonsporulating

===Strains===

Rhodococcus erythropolis RHA1

===Links===
=====Genomes=====
=====Transcriptomes=====
=====Proteomics=====
=====Protocols=====
====Availability====
=====Culture Collections=====

Rhodococcus erythropolis

2020-08-18T09:01:29Z

Alicia: /* Culture Collections */

Rhodococcus erythropolis

2020-08-18T09:01:15Z

Alicia: /* Culture Collections */

Rhodococcus erythropolis

2020-08-18T08:59:11Z

Alicia: Created page with "==Organism Page== === ''Rhodococcus erythropolis'' === ===Background=== ===Growth & Maintenance=== GYM =====Sporulation===== Nonsporulating ===Strains=== Rhodo..."

Tri-parental mating

2020-08-11T16:01:18Z

Alicia:

=Tri-parental Mating=

This protocol has been confirmed to work for the following organisms.
*[[Streptomyces coelicolor]]
*[[Streptomyces formicae]]
*[[Streptomyces venezuelae]]

===Tri-Parental Mating===
Tri-parental mating is useful for conjugating large plasmids, such as PAC clones (see [[PAC cloning]]), or those containing a kanamycin resistance gene as a selectable marker into ''Streptomyces''. In the standard [[ET Conjugation]] protocol a helper plasmid, [[pUZ8002]], is used in the ''Escherichia coli'' strain ET12567 (''E. coli'' ET12567) to transfer the desired vector to ''Streptomyces''. This [[pUZ8002]] helper plasmid contains a kanamycin resistance gene. This means that, if your desired plasmid contains a kanamycin resistance gene as marker (e.g. [[pRT802]]), it would be impossible to select for this vector when transforming ''E. coli'' ET12567 due to the kanamycin resistance gene already present on [[pUZ8002]].

To circumvent this issue, tri-parental mating is used. This transforms ''E. coli'' ET12567 with your vector of choice (donated from a parental ''E. coli'' strain) and a different helper plasmid, [[pR9604]], which contains an ampicillin/carbenicillin resistance gene as a selectable marker (donated from the parental strain ''E. coli'' TOP10 pR9604). The protocol then uses Amp/Carb to select for the helper plasmid, and kanamycin can be used to select for your desired vector. At the end an ''E. coli'' ET12567 strain is generated with an Carb/Amp selectable helper plasmid, and your kanamycin-marked vector of choice.

===Protocol===
Strains needed:
# ''E. coli'' TOP10 donor strain containing the self‐transmissible helper plasmid pR9604 (CarbR/AmpR).
# ''E. coli'' donor strain containing your vector of choice
# ''E. coli'' ET12567 recipient strain (ChlR)

Materials needed needed:
# Liquid [[LB]] medium
# Solid [[LB]] agar containing no antibiotics
# Solid [[LB]] agar containing chloramphenicol, carbenicillin/ampicillin and kanamycin
# Sterile loop/toothpicks

* Sub‐culture overnight cultures of each strain into fresh [[LB]] and grow them to exponential phase. Note: the strains have different growth rates, so carry out a trial experiment under local conditions first. See the [[Antibiotic stocks and working concentrations]] page for recommended antibiotic concentrations.

* Pellet cells via centrifugation, discard the supernatent and resuspend the pellet in fresh [[LB]]. Do this twice to remove residual antibiotics.

* After a final spin, resuspend each pellet in 500μl of fresh [[LB]].

* Spot 10 to 20 μl of each strain onto the same location on the [[LB]] agar plates containing no antibiotics so that the three strains are mixed together. Wait for the spots to dry in and incubate at 37ºC overnight. (Note: Pilli are very fragile and sheared off in liquid culture so performing the triparentel mating on solid medium is recommended.)

* The next day, prepare [[LB]] agar plates containing kanamycin, carbenicillin/ampicillin and chloramphenicol to select for E. coli 12567 derivatives containing both the helper plasmid, and your desired kanamycin-marked vector.

* Using a sterile loop or toothpick, streak the overnight incubated spots onto the LB plates containing Kan, Amp/Carb and Chl for single colonies and incubate overnight at 37ºC.

* After overnight incubation, inoculate single colonies into liquid [[LB]] medium broth containing Kan, Amp/Carb and Chl. If possible carry out PCR analysis to confirm the presence your desired vector.

* This new ''E. coli'' ET12567 strain, containing both [[pR9604]] and your desired kanamycin-marked vector can now be glycerol stocked, and used to conjugate your vector into ''Streptomyces'' via the standard [[ET Conjugation]] protocol.

====Notes====
#Ampicillin and Carbenicillin can be used intergangably.
#''E. coli'' ET12567 contains a chloramphenicol resistance gene integrated into the genome.

Protocol adapted for ActinoBase by Samuel M.M. Prudence from the University of East Anglia.

The ActinoBase e-Seminar

2020-04-18T11:43:32Z

Alicia:

=The ActinoBase e-Seminar Series=

The ActinoBase e-Seminar Series is an opportunity for both early-career and established researchers in the Actinobacteria community to share their work.

Two speakers each deliver a half hour presentation (twenty minute talks followed by ten minutes of audience Q&A), streamed directly to YouTube from a google hangout with the opportunity for their presentations to be uploaded to the ActinoBase channel. Each seminar is moderated by at least two early-career researchers who introduce the speaker and select questions from the stream chat.

The seminar is broadcast every Thursday (times TBC) and can be accessed via [https://www.youtube.com/channel/UCl-gE1rlZPLfBo7MXuD1DNA the Actinobase YouTube channel]. To register interest in participation, as well as sign up to mailing-list notifications, please fill out our [https://docs.google.com/forms/d/e/1FAIpQLSdHbIL88FAWe-qQaPJY362fe6-NyZkTg7HvDt8T30m_K8C-6Q/viewform google form].

==Upcoming Talks==

30.04.20 (3PM BST)

*Dr. Sven Sporulatesinbroth: Title TBC
*Prof. Di Giosin: Title TBC

07.05.20 (Time TBC)

*Speakers TBC

==Previous Talks==

=Organising committee=

The ActinoBase e-Seminar series is organised by a team of early-career Actinobacteria researchers, if you have any questions about the seminars then feel free to contact any of the members below:

The ActinoBase team: teamwikimyces@gmail.com

Sam Prudence - PhD Student, University of East Anglia: s.prudence@uea.ac.uk

David Mark - PhD Student, University of Strathclyde: david.mark@strath.ac.uk

Alicia Russell - PhD Student, John Innes Centre: alicia.russell@jic.ac.uk

Admin contact page

2020-02-12T11:07:40Z

Alicia:

__NOTOC__

<h2>How can you contribute?</h2>

ActinoBase is resource being built by the community and for the community. If you are an actinomycete expert and would like to help by contributing your own resources, please contact one of the site administrators using the below contact details. You can contribute as much or as little as you like, every little helps! See [[Contribution Guidelines]] for tips and guidelines on how to contribute to ActinoBase.

'''ActinoBase'''

Email: teamwikimyces@gmail.com

Twitter: [https://twitter.com/ActinoBase @ActinoBase]

'''Professor Matt Hutchings''' Site editor

[http://www.hutchingslab.uk Lab Website] [https://people.uea.ac.uk/m_hutchings UEA website]

Email: m.hutchings@uea.ac.uk

Twitter: [https://twitter.com/MattHutchings10 @MattHutchings10]

'''Sam Prudence''' Site Editor

Email: s.prudence@uea.ac.uk

Twitter: [https://twitter.com/Sam_Prudence @Sam_Prudence]

'''Dr. Lorena Fernández-Martínez''' Site Editor

Email: fernandl@edgehill.ac.uk

Twitter : [https://twitter.com/lore_fermar @lore_fermar]

'''Dr. Morgan Feeney''' Site Editor

Email: morgan.feeney@strath.ac.uk

Twitter: [https://twitter.com/Mostlymicrobia @Mostlymicrobia]

'''Dr. Katherine R. Duncan''' Site Editor

Email: katherine.duncan@strath.ac.uk

Twitter : [https://twitter.com/kate_duncan @kate_duncan]

Admin contact page

2020-02-12T11:06:46Z

Alicia:

__NOTOC__

<h2>How can you contribute?</h2>

Actinobase is resource being built by the community and for the community. If you are an actinomycete expert and would like to help by contributing your own resources, please contact one of the site administrators using the below contact details. You can contribute as much or as little as you like, every little helps! See [[Contribution Guidelines]] for tips and guidelines on how to contribute to ActinoBase.

'''ActinoBase'''

Email: teamwikimyces@gmail.com

Twitter: [https://twitter.com/ActinoBase @ActinoBase]

'''Professor Matt Hutchings''' Site editor

[http://www.hutchingslab.uk Lab Website] [https://people.uea.ac.uk/m_hutchings UEA website]

Email: m.hutchings@uea.ac.uk

Twitter: [https://twitter.com/MattHutchings10 @MattHutchings10]

'''Sam Prudence''' Site Editor

Email: s.prudence@uea.ac.uk

Twitter: [https://twitter.com/Sam_Prudence @Sam_Prudence]

'''Dr. Lorena Fernández-Martínez''' Site Editor

Email: fernandl@edgehill.ac.uk

Twitter : [https://twitter.com/lore_fermar @lore_fermar]

'''Dr. Morgan Feeney''' Site Editor

Email: morgan.feeney@strath.ac.uk

Twitter: [https://twitter.com/Mostlymicrobia @Mostlymicrobia]

'''Dr. Katherine R. Duncan''' Site Editor

Email: katherine.duncan@strath.ac.uk

Twitter : [https://twitter.com/kate_duncan @kate_duncan]

Recruitment

2020-02-12T11:03:16Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

Postgraduate opportunities at the John Innes Centre: find out more [https://www.jic.ac.uk/training-careers/postgraduate-opportunities/current-postgraduate-research-opportunities/ here]

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
*This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020.
*Find out more and apply [https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/ here]

If you wish to advertise an opportunity, but do not have editor access to ActinoBase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Recruitment

2019-10-23T10:40:20Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

Postgraduate opportunities at the John Innes Centre: find out more [https://www.jic.ac.uk/training-careers/postgraduate-opportunities/current-postgraduate-research-opportunities/ here]

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
*This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020.
*Find out more and apply [https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/ here]

If you wish to advertise an opportunity, but do not have editor access to Acinobase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Recruitment

2019-10-23T10:15:34Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

Postgraduate opportunities at the John Innes Centre: find out more [https://www.jic.ac.uk/training-careers/postgraduate-opportunities/current-postgraduate-research-opportunities/ here]

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
*This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020.
*Find out more and apply [https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/ here]

If you wish to advertise an opportunity, but do not have editor access to Acinobase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Recruitment

2019-10-23T10:15:00Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

Postgraduate opportunities at the John Innes Centre: find out more [https://www.jic.ac.uk/training-careers/postgraduate-opportunities/current-postgraduate-research-opportunities/ here]

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
*This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020.
*Find out more and apply [https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/ here]

If you wish to advertise an opportunity, but do not have editor access to Acinobase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Recruitment

2019-10-23T10:09:20Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
*This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020.
*Find out more and apply [https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/ here]

If you wish to advertise an opportunity, but do not have editor access to Acinobase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Recruitment

2019-10-23T10:08:48Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
*This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020.
*Find out more and apply [https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/ here]

If you wish to advertise an opportunity, but do not have editor access to Acinobase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Recruitment

2019-10-23T10:04:08Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020. Find out more and apply here: https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/

If you wish to advertise an opportunity, but do not have editor access to Acinobase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Recruitment

2019-10-23T10:03:41Z

Alicia:

=Recruitment=
Please feel free to post information and links to job opportunities etc below:
*Please also remember to remove the links once filled or application expires.

=Opportunities=
Applied molecular microbiology summer school: 'Microbial Specialised Metabolites: Discovery, Biosynthesis and Evolution'
This is a fantastic summer school for early career researchers studying natural products, which takes place in Dubrovnik 5-12 September 2020. Applications close 14 February 2020. Find out more and apply [here https://www.jic.ac.uk/training-careers/summer-schools/applied-molecular-microbiology/]

If you wish to advertise an opportunity, but do not have editor access to Acinobase, please see the [[Admin contact page]] to either request an editors account, or request your oppotunity is advertised here.

Site-specific phage recombinase

2019-10-17T15:31:26Z

Alicia: /* Integration sites */

==Integration sites==
*You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:

ΦBT1, attB:
GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG

ΦC31, attB:
CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC

ΦJoe, attB:
ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG

==References==

Site-specific phage recombinase

2019-10-17T15:22:40Z

Alicia:

==Integration sites==
*You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:

ΦBT1, attB:
GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG

ΦC31, attB:
CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC

ΦJoe, attB:
ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG

==References==

Site-specific phage recombinase

2019-10-17T15:19:45Z

Alicia:

Integration sites
*You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:

ΦBT1, attB:
GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG

ΦC31, attB:
CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC

ΦJoe, attB:
ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG

Site-specific phage recombinase

2019-10-17T15:17:46Z

Alicia:

Integration sites
*You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:

ΦBT1, attB:
GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG

ΦC31, attB:
CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC

ΦJoe:
ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG

Site-specific phage recombinase

2019-10-17T15:17:14Z

Alicia:

Integration sites
You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:

ΦBT1, attB:
GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG

ΦC31, attB:
CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC

ΦJoe:
ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG

Site-specific phage recombinase

2019-10-17T15:16:37Z

Alicia: Created page with "Integration sites You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid: *ΦBT1, attB..."

Integration sites
You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:

*ΦBT1, attB
GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG
*ΦC31, attB
CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC
*ΦJoe
ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG

PIJ773

2019-08-29T16:08:04Z

Alicia: /* References */

{{DISPLAYTITLE: pIJ773}}

==Use==

pIJ773 is a plasmid used during PCR targeting for mutagenesis experiments in actinomycetes. The plasmid is used as a template to amplify a disruption cassette by PCR, producing a 1382 bp fragment.

==Features==

*Apramycin resistance (aac(3)IV)
*oriT from RP4 plasmid (RK2)
*Flippase recognition target (FRT) sites

==History==

==Map==

==Sequence links==

==References==

# Gust, B., Challis, G. L., Fowler, K., Kieser, T., Chater, K. F. (2003) PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin Proceedings of the National Academy of Sciences of the United States of America. 100(4): 1541–1546.

PIJ773

2019-08-29T16:07:17Z

Alicia: /* References */

{{DISPLAYTITLE: pIJ773}}

==Use==

pIJ773 is a plasmid used during PCR targeting for mutagenesis experiments in actinomycetes. The plasmid is used as a template to amplify a disruption cassette by PCR, producing a 1382 bp fragment.

==Features==

*Apramycin resistance (aac(3)IV)
*oriT from RP4 plasmid (RK2)
*Flippase recognition target (FRT) sites

==History==

==Map==

==Sequence links==

==References==

# Gust, B., Challis, G. L., Fowler, K., Kieser, T., Chater, K. F. (2003) PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin Proceedings of the National Academy of Sciences of the United States of America. 100(4): 1541–1546.

PIJ773

2019-08-29T16:04:36Z

Alicia: /* Features */

PIJ773

2019-08-29T15:49:49Z

Alicia: /* Features */

PIJ773

2019-08-29T15:42:22Z

Alicia: /* Features */

PIJ773

2019-08-29T15:41:58Z

Alicia: /* Features */

PIJ773

2019-08-29T15:37:42Z

Alicia: /* Use */

PIJ773

2019-08-29T15:37:18Z

Alicia: /* Use */

{{DISPLAYTITLE: pIJ773}}

==Use==

pIJ773 is a plasmid used for during PCR targeting for mutagenesis experiments in actinomycetes. The plasmid is used as a template to amplify a disruption cassette by PCR, producing a 1382 bp fragment.

==Features==

==History==

==Map==

==Sequence links==

==References==

Genome mining tools

2019-08-16T13:28:42Z

Alicia:

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

[https://antismash.secondarymetabolites.org/#!/start antiSMASH]:1 (antibiotics and Secondary Metabolite Analysis Shell)
*Identification and annotation of secondary metabolite gene clusters
*[https://twitter.com/antiSMASH_dev Twitter]

[http://grid.adapsyn.com/prism/#!/prism PRISM]:2 (PRediction Informatics for Secondary Metabolism)
*Identification of nonribosomal peptides, type I and II polyketides and RiPPs

[http://bagel4.molgenrug.nl/ BAGEL]:3
* Identification of gene clusters for bacteriocins and RiPPs

[https://omictools.com/clusean-tool CLUSEAN]:4
*Annotation and analysis of secondary metabolite gene clusters

[https://github.com/petercim/ClusterFinder ClusterFinder]:5
*Identification of secondary metabolite gene clusters

[https://arts3.ziemertlab.com/ ARTS]:6 (Antibiotic Resistant Target Seeker)
*Genome mining for secondary metabolites and potential antibiotics based on antibiotic resistance targets

[https://sourceforge.net/projects/secmetdb/ 2metDB]:7
*Genome mining for polyketides and nonribosomal peptides

[http://pks.kaist.ac.kr/pkminer/ PKMiner]:8
*Genome mining for type II polyketide synthases

[http://www.nii.ac.in/sbspks2.html SBSPKS]:9
*Sequence analysis of polyketide synthases

[http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php RiPPMINER]:10
*Genome mining and deciphering chemical structures of RiPPs

[http://www.ripprodeo.org/manual.html RODEO]:11 (Rapid ORF Description and Evaluation Online)
*Identification of biosynthetic gene clusters and prediction of RiPP precursor peptides

[https://github.com/streptomyces/ripper RiPPER]:12
*Identification of RiPP precursor peptides and biosynthetic gene clusters

[https://omictools.com/big-scape-tool BiG-SCAPE]

[https://github.com/nselem/EvoMining/wiki EvoMining]

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

Genome mining tools

2019-08-16T10:53:26Z

Alicia:

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

antiSMASH:1 https://antismash.secondarymetabolites.org/#!/start
*Twitter: https://twitter.com/antiSMASH_dev

PRISM:2 http://grid.adapsyn.com/prism/#!/prism

BAGEL:3 http://bagel4.molgenrug.nl/

CLUSEAN:4 https://omictools.com/clusean-tool

ClusterFinder:5 https://github.com/petercim/ClusterFinder

CASSIS:6 https://sbi.hki-jena.de/cassis/

ARTS:7 https://arts3.ziemertlab.com/

2metDB:8 https://sourceforge.net/projects/secmetdb/

PKMiner:9 http://pks.kaist.ac.kr/pkminer/

SBSPKS:10 http://www.nii.ac.in/sbspks2.html

RiPPMINER:11 http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php

RODEO:12 http://www.ripprodeo.org/manual.html

RiPPER:13 https://github.com/streptomyces/ripper

BiG-SCAPE: https://omictools.com/big-scape-tool

EvoMining: https://github.com/nselem/EvoMining/wiki

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Wolf, T., Shelest, V., Nath, N., Shelest, E. (2015) CASSIS and SMIPS: promoter-based prediction of secondary metabolite gene clusters in eukaryotic genomes. Bioinformatics, 32:1138-43 doi: 10.1093/bioinformatics/btv713.
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

Genome mining tools

2019-08-16T10:49:24Z

Alicia:

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

antiSMASH:1 https://antismash.secondarymetabolites.org/#!/start
*Twitter: https://twitter.com/antiSMASH_dev

PRISM:2 http://grid.adapsyn.com/prism/#!/prism

BAGEL:3 http://bagel4.molgenrug.nl/

CLUSEAN:4 https://omictools.com/clusean-tool

ClusterFinder:5 https://github.com/petercim/ClusterFinder

CASSIS:6 https://sbi.hki-jena.de/cassis/

ARTS:7 https://arts3.ziemertlab.com/

2metDB:8 https://sourceforge.net/projects/secmetdb/

PKMiner:9 http://pks.kaist.ac.kr/pkminer/

SBSPKS:10 http://www.nii.ac.in/sbspks2.html

RiPPMINER:11 http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php

RODEO:12 http://www.ripprodeo.org/manual.html

RiPPER:13 https://github.com/streptomyces/ripper

BiG-SCAPE: https://omictools.com/big-scape-tool

EvoMining: https://github.com/nselem/EvoMining/wiki

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences Nucleic Acids Research 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes et al, Nucleic Acids Research doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins Nucleic Acids Research 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusterset al, Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters (2014) et al, Cell 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Wolf, T., Shelest, V., Nath, N., Shelest, E. (2015) CASSIS and SMIPS: promoter-based prediction of secondary metabolite gene clusters in eukaryotic genomes Bioinformatics, 32:1138-43 doi: 10.1093/bioinformatics/btv713.
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery Nucleic Acids Research doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data Methods in Enzymology 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases BMC Microbiology 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases Nucleic Acids Research ;38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links Nucleic Acids Research 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape Nature Chemical Biology 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

Genome mining tools

2019-08-16T10:38:21Z

Alicia:

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

antiSMASH:1 https://antismash.secondarymetabolites.org/#!/start
*Twitter: https://twitter.com/antiSMASH_dev

PRISM:2 http://grid.adapsyn.com/prism/#!/prism

BAGEL:3 http://bagel4.molgenrug.nl/

CLUSEAN:4 https://omictools.com/clusean-tool

ClusterFinder:5 https://github.com/petercim/ClusterFinder

CASSIS:6 https://sbi.hki-jena.de/cassis/

ARTS:7 https://arts3.ziemertlab.com/

2metDB:8 https://sourceforge.net/projects/secmetdb/

PKMiner:9 http://pks.kaist.ac.kr/pkminer/

SBSPKS:10 http://www.nii.ac.in/sbspks2.html

RiPPMINER:11 http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php

RODEO:12 http://www.ripprodeo.org/manual.html

RiPPER:13 https://github.com/streptomyces/ripper

BiG-SCAPE: https://omictools.com/big-scape-tool

EvoMining: https://github.com/nselem/EvoMining/wiki

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences Nucleic Acids Research 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes et al, Nucleic Acids Research doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins Nucleic Acids Research 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusterset al, Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters (2014) et al, Cell 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Wolf, T., Shelest, V., Nath, N., Shelest, E. (2015) CASSIS and SMIPS: promoter-based prediction of secondary metabolite gene clusters in eukaryotic genomes Bioinformatics, 32:1138-43 doi: 10.1093/bioinformatics/btv713.
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery Nucleic Acids Research doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data Methods in Enzymology 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases BMC Microbiology 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases Nucleic Acids Research ;38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Nucleic Acids Res. 2017 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Nat Chem Biol. 2017;13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J. et al Nucleic Acids Research, 2019, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

Genome mining tools

2019-08-16T10:37:33Z

Alicia:

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

antiSMASH:1 https://antismash.secondarymetabolites.org/#!/start
*Twitter: https://twitter.com/antiSMASH_dev

PRISM:2 http://grid.adapsyn.com/prism/#!/prism

BAGEL:3 http://bagel4.molgenrug.nl/

CLUSEAN:4 https://omictools.com/clusean-tool

ClusterFinder:5 https://github.com/petercim/ClusterFinder

CASSIS:6 https://sbi.hki-jena.de/cassis/

ARTS:7 https://arts3.ziemertlab.com/

2metDB:8 https://sourceforge.net/projects/secmetdb/

PKMiner:9 http://pks.kaist.ac.kr/pkminer/

SBSPKS:10 http://www.nii.ac.in/sbspks2.html

RiPPMINER:11 http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php

RODEO:12 http://www.ripprodeo.org/manual.html

RiPPER:13 https://github.com/streptomyces/ripper

BiG-SCAPE: https://omictools.com/big-scape-tool

EvoMining: https://github.com/nselem/EvoMining/wiki

#1. Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences Nucleic Acids Research 1; 39 doi: 10.1093/nar/gkr466
#2. Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes et al, Nucleic Acids Research doi: 10.1093/nar/gkx320
#3. Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins Nucleic Acids Research 2;46 doi: org/10.1093/nar/gky383.
#4. Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusterset al, Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
#5. Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters (2014) et al, Cell 158:412-21 doi: 10.1016/j.cell.2014.06.034
#6. Wolf, T., Shelest, V., Nath, N., Shelest, E. (2015) CASSIS and SMIPS: promoter-based prediction of secondary metabolite gene clusters in eukaryotic genomes Bioinformatics, 32:1138-43 doi: 10.1093/bioinformatics/btv713.
#7. Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery Nucleic Acids Research doi: 10.1093/nar/gkx360
#8. Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data Methods in Enzymology 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
#9. Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases BMC Microbiology 8;12:169. doi: 10.1186/1471-2180-12-169.
#10. Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases Nucleic Acids Research ;38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
#11. Agrawal, P., Nucleic Acids Res. 2017 3;45 doi: 10.1093/nar/gkx408.
#12. Tietz, J. I., Nat Chem Biol. 2017;13(5):470-478 doi: 10.1038/nchembio.2319.
#13. Santos-Aberturas, J. et al Nucleic Acids Research, 2019, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

Genome mining tools

2019-08-16T10:36:36Z

Alicia:

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

antiSMASH:1 https://antismash.secondarymetabolites.org/#!/start
*Twitter: https://twitter.com/antiSMASH_dev

PRISM:2 http://grid.adapsyn.com/prism/#!/prism

BAGEL:3 http://bagel4.molgenrug.nl/

CLUSEAN:4 https://omictools.com/clusean-tool

ClusterFinder:5 https://github.com/petercim/ClusterFinder

CASSIS:6 https://sbi.hki-jena.de/cassis/

ARTS:7 https://arts3.ziemertlab.com/

2metDB:8 https://sourceforge.net/projects/secmetdb/

PKMiner:9 http://pks.kaist.ac.kr/pkminer/

SBSPKS:10 http://www.nii.ac.in/sbspks2.html

RiPPMINER:11 http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php

RODEO:12 http://www.ripprodeo.org/manual.html

RiPPER:13 https://github.com/streptomyces/ripper

BiG-SCAPE: https://omictools.com/big-scape-tool

EvoMining: https://github.com/nselem/EvoMining/wiki

1. Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences Nucleic Acids Research 1; 39 doi: 10.1093/nar/gkr466
2. Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes et al, Nucleic Acids Research doi: 10.1093/nar/gkx320
3. Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins Nucleic Acids Research 2;46 doi: org/10.1093/nar/gky383.
4. Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusterset al, Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
5. Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters (2014) et al, Cell 158:412-21 doi: 10.1016/j.cell.2014.06.034
6. Wolf, T., Shelest, V., Nath, N., Shelest, E. (2015) CASSIS and SMIPS: promoter-based prediction of secondary metabolite gene clusters in eukaryotic genomes Bioinformatics, 32:1138-43 doi: 10.1093/bioinformatics/btv713.
7. Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery Nucleic Acids Research doi: 10.1093/nar/gkx360
8. Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data Methods in Enzymology 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
9. Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases BMC Microbiology 8;12:169. doi: 10.1186/1471-2180-12-169.
10. Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases Nucleic Acids Research ;38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
11. Agrawal, P., Nucleic Acids Res. 2017 3;45 doi: 10.1093/nar/gkx408.
12. Tietz, J. I., Nat Chem Biol. 2017;13(5):470-478 doi: 10.1038/nchembio.2319.
13. Santos-Aberturas, J. et al Nucleic Acids Research, 2019, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

Groups

2019-08-14T11:59:43Z

Alicia: /* Research Groups List */

Below is an alphabetical list of research groups working on Streptomyces, closely related actinomycete bacteria and their natural products. *Indicates membership of the international organising committee for ISBA the International Symposium on the Biology of Actinomycetes. If you'd like to be added please contact us via [https://twitter.com/ActinoBase @actinobase] or use the contact link in the menu bar.

====World Map of Research Groups====
<html>
<iframe src="https://www.google.co.uk/maps/d/u/0/embed?mid=14bRNmsDo2vIXP_I8CVOgW4DJGB7ewkuf" width="640" height="480"></iframe>
</html>

====Research Groups List====
[https://scholar.google.co.uk/citations?user=0TuurLQAAAAJ Prof. Bertrand Aigle]

[http://fcm.ens.uabc.mx/?p=personal.php&per=nmillan Prof. Natalie Millán Aguiñaga]

[https://langebio.cinvestav.mx/en/Dr-Francisco-Barona Dr. Paco Barona-Gomez] *

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/bera/ Dr. Agnieszka Bera]

[https://www.faculty.mun.ca/dbignell/ Dr. Dawn Bignell]

[https://sites.wustl.edu/blodgettlab/ Prof. Joshua Blodgett]

[https://blogs.cornell.edu/buckley/ Prof. Dan Buckley]

[https://www.jic.ac.uk/people/mark-buttner/ Prof. Mark Buttner]

Prof. Beatriz Cámara

[https://warwick.ac.uk/fac/sci/chemistry/research/challis/challisgroup Prof. Greg Challis]

[http://www.claessen-lab.nl/ Prof. Dennis Claessen]

[https://www.lerner.ccf.org/cms/claesen/ Prof. Jan Claesen]

[https://www.corre-lab.com/ Prof. Chris Corre]

[https://www.proimi.org.ar/miembros/dr-jose-sebastian-davila-costa Dr. José Sebastián Davila Costa]

[https://www.abdn.ac.uk/ncs/profiles/h.deng Dr. Hai Deng]

[http://skmml.sjtu.edu.cn/en/Faculty_Content.aspx?id=43 Prof. Zixin Deng] *

[http://publish.ucc.ie/researchprofiles/D021/adobson Prof. Alan Dobson]

Prof. Cristina Dorador

[http://www.naicons.com/about-us/management-team/stefano-donadio.html Dr. Stefano Donadio] *

[https://www.strath.ac.uk/staff/duncankatherinedr/ Dr. Kate Duncan]

[https://www.abdn.ac.uk/ncs/people/ncs/profiles/r.ebel Dr. Rainer Ebel]

[https://fhs.mcmaster.ca/biochem/elliot_marie.html Prof. Marie Elliot]

[https://eustaquio.lab.uic.edu Dr. Alessandra Eustaquio]

[http://scrippsscholars.ucsd.edu/wfenical Prof. William Fenical]

[https://www.biology.lu.se/klas-flardh Prof. Klas Flärdh]

[https://www.abdn.ac.uk/ncs/profiles/m.jaspars/ Prof. Marcel Jaspars]

[https://imbm.co.za/staff/dr-bronywn-kirby/ Dr. Bronwyn Kirby-McCullough]

Prof. Luis Maldonado

[http://www.uniovi.es/en/-/manteca-fernandez-angel Prof. Angel Manteca]

[https://www.edgehill.ac.uk/biology/staff/lorena-fernandez-martinez/ Dr. Lorena Fernández-Martínez]

[https://www.flinders.edu.au/people/chris.franco Prof. Chris Franco] *

[https://www.strath.ac.uk/staff/herronpauldr/ Dr. Paul Herron]

[https://www.strath.ac.uk/staff/hoskissonpauldr/ Prof. Paul Hoskisson] *

[https://www.geomar.de/en/mitarbeiter/fb3/ms/uhentschel/ Prof. Ute Hentschel]

[https://people.uea.ac.uk/m_hutchings Prof. Matt Hutchings]

[http://www.ibmb.uni.wroc.pl/zmm/jakimowicz.html Prof. Dagmara Jakimowicz]

[http://scrippsscholars.ucsd.edu/pjensen Prof. Paul Jensen]

[https://people.uea.ac.uk/g_kelemen Dr. Gabriela Kelemen]

[https://scholar.google.co.uk/citations?user=yL6B0g8AAAAJ Prof. Pierre Leblonde]

[https://www.unipa.it/persone/docenti/p/a.maria.puglia Prof. Anna Maria Puglia]

[http://loesgenlab.org/ Prof. Sandra Loesgen]

[https://pppmb.cals.cornell.edu/people/rosemary-loria/ Prof. Rose Loria] *

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/mast/ Dr. Yvonne Mast]

[https://www.duq.edu/academics/faculty/joseph-mccormick Prof. Joe McCormick]

[https://chemistry.illinois.edu/douglasm Prof. Douglas Mitchell]

[http://scrippsscholars.ucsd.edu/bsmoore/pages/moore-lab-research Prof. Bradley Moore]

[https://jgi.doe.gov/about-us/organization/strategic-management/nigel-mouncey/ Dr. Nigel Mouncey]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/musiol-kroll/ Dr. Ewa Musiol-Kroll]

[https://uni-tuebingen.de/en/faculties/faculty-of-science/departments/interfaculty-facilities/imit/research-groups/microbiology-biotechnology/research-groups/muth/ Dr. Gunter Muth]

[http://biochemistry.utoronto.ca/person/justin-r-nodwell/ Prof. Justin Nodwell] *

[http://www.sussex.ac.uk/profiles/117009 Dr. Mark Paget]

[https://micro.biol.ethz.ch/research/piel.html Prof. Jorn Piel]

[http://biosci.snu.ac.kr/en/people/faculty?mode=view&profidx=13 Prof. Jung-Hye Roe] *

[http://cput.academia.edu/MarilizeLeRoesHill Dr. Marilize Le Roes-Hill]

Prof. Richard Samuels

[https://pharmacy.uic.edu/profiles/sanchelm/ Dr. Laura Sanchez]

[https://www.northumbria.ac.uk/about-us/our-staff/s/dr-vartul-sangal/ Dr. Vartul Sangal]

[https://www.biologie.uni-halle.de/microbiology/sawers/ Prof. Gary Sawers]

[https://www.schlimpertlab.com Dr. Susan Schlimpert]

[https://biologicalsciences.leeds.ac.uk/molecular-and-cellular-biology/staff/134/dr-ryan-f-seipke Dr. Ryan Seipke]

[https://www.york.ac.uk/biology/research/molecular-microbiology/maggie-smith/ Prof. Maggie Smith]

[https://research.brighton.ac.uk/en/persons/colin-smith Prof. Colin Smith]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-institute-und-zentren/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/stegmann/ Dr. Evi Stegmann]

[https://biochemistry.tamu.edu/people/straight-paul/ Dr. Paul Straight]

[https://www.northumbria.ac.uk/about-us/our-staff/s/professor-iain-sutcliffe/ Prof. Iain Sutcliffe]

[https://www.faculty.mun.ca/ktahlan/ Dr. Kapil Tahlan]

[https://www.research.manchester.ac.uk/portal/eriko.takano.html Prof. Eriko Takano]

[https://www.biologie.hu-berlin.de/de/gruppenseiten/mikrobiologie/tschowri_group Dr. Natalia Tschowri]

[https://scholar.google.co.th/citations?user=xj8zuvoAAAAJ&hl=th Prof. Arinthip Thamchaipenet] *

[https://people.csiro.au/T/L/Louise-Thatcher Dr. Louise Thatcher]

[https://plantandmicrobiology.berkeley.edu/profile/traxler Dr. Matt Traxler]

[https://scholar.google.es/citations?user=t4UxSxEAAAAJ&hl=en Dr. Martha Trujillo] *

[https://www.jic.ac.uk/people/andrew-truman/ Dr. Andy Truman]

Dr. Kenji Ueda *

[https://chemistry.illinois.edu/vddonk Prof. Wilfred van der Donk]

[https://www.swansea.ac.uk/staff/medicine/learningandteaching/vankeuleng/ Dr. Geertje van Keulen]

[https://www.universiteitleiden.nl/en/staffmembers/gilles-van-wezel#tab-1 Prof. Gilles van Wezel] *

[https://www.irb.hr/eng/About-RBI/People/Dusica-Vujaklija Dr. Dusica Vujaklija]

[https://warwick.ac.uk/fac/sci/lifesci/people/ewellington/ Prof. Liz Wellington] *

[https://www.jic.ac.uk/people/professor-barrie-wilkinson/ Prof. Barrie Wilkinson]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-institute-und-zentren/imit/arbeitsgruppen/mikrobiologie-biotechnologie/ Prof. Wolfgang Wohlleben] *

[http://www.thewrightlab.com Prof. Gerry Wright]

[http://www.ibmb.uni.wroc.pl/zmm/zakrzewska.html Dr. Jolanta Zakrzewska-Czerwińska]

[http://zhanglab.caspmi.cn/?people/current-members/zhanglixin.html Prof. Lixin Zhang] *

[http://faculty.scs.illinois.edu/~zhaogrp/ Prof. Huimin Zhao]

[https://uni-tuebingen.de/en/faculties/faculty-of-science/departments/interfaculty-institutes-and-centres/imit/research-groups/applied-natural-products-genome-mining/ Prof. Nadine Ziemert]

Groups

2019-08-14T11:57:18Z

Alicia: /* Research Groups List */

Below is an alphabetical list of research groups working on Streptomyces, closely related actinomycete bacteria and their natural products. *Indicates membership of the international organising committee for ISBA the International Symposium on the Biology of Actinomycetes. If you'd like to be added please contact us via [https://twitter.com/ActinoBase @actinobase] or use the contact link in the menu bar.

====World Map of Research Groups====
<html>
<iframe src="https://www.google.co.uk/maps/d/u/0/embed?mid=14bRNmsDo2vIXP_I8CVOgW4DJGB7ewkuf" width="640" height="480"></iframe>
</html>

====Research Groups List====
[https://scholar.google.co.uk/citations?user=0TuurLQAAAAJ Prof. Bertrand Aigle]

[http://fcm.ens.uabc.mx/?p=personal.php&per=nmillan Prof. Natalie Millán Aguiñaga]

[https://langebio.cinvestav.mx/en/Dr-Francisco-Barona Dr. Paco Barona-Gomez] *

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/bera/ Dr. Agnieszka Bera]

[https://www.faculty.mun.ca/dbignell/ Dr. Dawn Bignell]

[https://sites.wustl.edu/blodgettlab/ Prof. Joshua Blodgett]

[https://blogs.cornell.edu/buckley/ Prof. Dan Buckley]

[https://www.jic.ac.uk/people/mark-buttner/ Prof. Mark Buttner]

Prof. Beatriz Cámara

[https://warwick.ac.uk/fac/sci/chemistry/research/challis/challisgroup Prof. Greg Challis]

[http://www.claessen-lab.nl/ Prof. Dennis Claessen]

[https://www.lerner.ccf.org/cms/claesen/ Prof. Jan Claesen]

[https://www.corre-lab.com/ Prof. Chris Corre]

[https://www.proimi.org.ar/miembros/dr-jose-sebastian-davila-costa Dr. José Sebastián Davila Costa]

[https://www.abdn.ac.uk/ncs/profiles/h.deng Dr. Hai Deng]

[http://skmml.sjtu.edu.cn/en/Faculty_Content.aspx?id=43 Prof. Zixin Deng] *

[http://publish.ucc.ie/researchprofiles/D021/adobson Prof. Alan Dobson]

Prof. Cristina Dorador

[http://www.naicons.com/about-us/management-team/stefano-donadio.html Dr. Stefano Donadio] *

[https://www.strath.ac.uk/staff/duncankatherinedr/ Dr. Kate Duncan]

[https://www.abdn.ac.uk/ncs/people/ncs/profiles/r.ebel Dr. Rainer Ebel]

[https://fhs.mcmaster.ca/biochem/elliot_marie.html Prof. Marie Elliot]

[https://eustaquio.lab.uic.edu Dr. Alessandra Eustaquio]

[http://scrippsscholars.ucsd.edu/wfenical Prof. William Fenical]

[https://www.biology.lu.se/klas-flardh Prof. Klas Flärdh]

[https://www.abdn.ac.uk/ncs/profiles/m.jaspars/ Prof. Marcel Jaspars]

[https://imbm.co.za/staff/dr-bronywn-kirby/ Dr. Bronwyn Kirby-McCullough]

Prof. Luis Maldonado

[http://www.uniovi.es/en/-/manteca-fernandez-angel Prof. Angel Manteca]

[https://www.edgehill.ac.uk/biology/staff/lorena-fernandez-martinez/ Dr. Lorena Fernández-Martínez]

[https://www.flinders.edu.au/people/chris.franco Prof. Chris Franco] *

[https://www.strath.ac.uk/staff/herronpauldr/ Dr. Paul Herron]

[https://www.strath.ac.uk/staff/hoskissonpauldr/ Prof. Paul Hoskisson] *

[https://www.geomar.de/en/mitarbeiter/fb3/ms/uhentschel/ Prof. Ute Hentschel]

[https://people.uea.ac.uk/m_hutchings Prof. Matt Hutchings]

[http://www.ibmb.uni.wroc.pl/zmm/jakimowicz.html Prof. Dagmara Jakimowicz]

[http://scrippsscholars.ucsd.edu/pjensen Prof. Paul Jensen]

[https://people.uea.ac.uk/g_kelemen Dr. Gabriela Kelemen]

[https://scholar.google.co.uk/citations?user=yL6B0g8AAAAJ Prof. Pierre Leblonde]

[https://www.unipa.it/persone/docenti/p/a.maria.puglia Prof. Anna Maria Puglia]

[http://loesgenlab.org/ Prof. Sandra Loesgen]

[https://pppmb.cals.cornell.edu/people/rosemary-loria/ Prof. Rose Loria] *

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/mast/ Dr. Yvonne Mast]

[https://www.duq.edu/academics/faculty/joseph-mccormick Prof. Joe McCormick]

[https://chemistry.illinois.edu/douglasm Prof. Douglas Mitchell]

[http://scrippsscholars.ucsd.edu/bsmoore/pages/moore-lab-research Prof. Bradley Moore]

[https://jgi.doe.gov/about-us/organization/strategic-management/nigel-mouncey/ Dr. Nigel Mouncey]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/musiol-kroll/ Dr. Ewa Musiol-Kroll]

[https://uni-tuebingen.de/en/faculties/faculty-of-science/departments/interfaculty-facilities/imit/research-groups/microbiology-biotechnology/research-groups/muth/ Dr. Gunter Muth]

[http://biochemistry.utoronto.ca/person/justin-r-nodwell/ Prof. Justin Nodwell] *

[http://www.sussex.ac.uk/profiles/117009 Dr. Mark Paget]

[https://micro.biol.ethz.ch/research/piel.html Prof. Jorn Piel]

[http://biosci.snu.ac.kr/en/people/faculty?mode=view&profidx=13 Prof. Jung-Hye Roe] *

[http://cput.academia.edu/MarilizeLeRoesHill Dr. Marilize Le Roes-Hill]

Prof. Richard Samuels

[https://pharmacy.uic.edu/profiles/sanchelm/ Dr. Laura Sanchez]

[https://www.northumbria.ac.uk/about-us/our-staff/s/dr-vartul-sangal/ Dr. Vartul Sangal]

[https://www.biologie.uni-halle.de/microbiology/sawers/ Prof. Gary Sawers]

[https://www.schlimpertlab.com Dr. Susan Schlimpert]

[https://biologicalsciences.leeds.ac.uk/molecular-and-cellular-biology/staff/134/dr-ryan-f-seipke Dr. Ryan Seipke]

[https://www.york.ac.uk/biology/research/molecular-microbiology/maggie-smith/ Prof. Maggie Smith]

[https://research.brighton.ac.uk/en/persons/colin-smith Prof. Colin Smith]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-institute-und-zentren/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/stegmann/ Dr. Evi Stegmann]

[https://biochemistry.tamu.edu/people/straight-paul/ Dr. Paul Straight]

[https://www.northumbria.ac.uk/about-us/our-staff/s/professor-iain-sutcliffe/ Prof. Iain Sutcliffe]

[https://www.faculty.mun.ca/ktahlan/ Dr. Kapil Tahlan]

[https://www.research.manchester.ac.uk/portal/eriko.takano.html Prof. Eriko Takano]

[https://www.biologie.hu-berlin.de/de/gruppenseiten/mikrobiologie/tschowri_group Dr. Natalia Tschowri]

[https://scholar.google.co.th/citations?user=xj8zuvoAAAAJ&hl=th Prof. Arinthip Thamchaipenet] *

[https://people.csiro.au/T/L/Louise-Thatcher Dr. Louise Thatcher]

[https://plantandmicrobiology.berkeley.edu/profile/traxler Dr. Matt Traxler]

[https://scholar.google.es/citations?user=t4UxSxEAAAAJ&hl=en Dr. Martha Trujillo] *

[https://www.jic.ac.uk/people/andrew-truman/ Dr. Andy Truman]

Dr. Kenji Ueda *

[https://chemistry.illinois.edu/vddonk Prof. Wilfred van der Donk]

[https://www.swansea.ac.uk/staff/medicine/learningandteaching/vankeuleng/ Dr. Geertje van Keulen]

[https://www.universiteitleiden.nl/en/staffmembers/gilles-van-wezel#tab-1 Prof. Gilles van Wezel] *

[https://www.irb.hr/eng/About-RBI/People/Dusica-Vujaklija Dr. Dusica Vujaklija]

[https://warwick.ac.uk/fac/sci/lifesci/people/ewellington/ Prof. Liz Wellington] *

[https://www.jic.ac.uk/people/professor-barrie-wilkinson/ Prof. Barrie Wilkinson]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-institute-und-zentren/imit/arbeitsgruppen/mikrobiologie-biotechnologie/ Prof. Wolfgang Wohlleben] *

[http://www.thewrightlab.com Prof. Gerry Wright]

[http://www.ibmb.uni.wroc.pl/zmm/zakrzewska.html Dr. Jolanta Zakrzewska-Czerwińska]

[http://zhanglab.caspmi.cn/?people/current-members/zhanglixin.html Prof. Lixin Zhang] *

[https://uni-tuebingen.de/en/faculties/faculty-of-science/departments/interfaculty-institutes-and-centres/imit/research-groups/applied-natural-products-genome-mining/ Prof. Nadine Ziemert]

Groups

2019-08-14T11:54:43Z

Alicia: /* Research Groups List */

Below is an alphabetical list of research groups working on Streptomyces, closely related actinomycete bacteria and their natural products. *Indicates membership of the international organising committee for ISBA the International Symposium on the Biology of Actinomycetes. If you'd like to be added please contact us via [https://twitter.com/ActinoBase @actinobase] or use the contact link in the menu bar.

====World Map of Research Groups====
<html>
<iframe src="https://www.google.co.uk/maps/d/u/0/embed?mid=14bRNmsDo2vIXP_I8CVOgW4DJGB7ewkuf" width="640" height="480"></iframe>
</html>

====Research Groups List====
[https://scholar.google.co.uk/citations?user=0TuurLQAAAAJ Prof. Bertrand Aigle]

[http://fcm.ens.uabc.mx/?p=personal.php&per=nmillan Prof. Natalie Millán Aguiñaga]

[https://langebio.cinvestav.mx/en/Dr-Francisco-Barona Dr. Paco Barona-Gomez] *

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/bera/ Dr. Agnieszka Bera]

[https://www.faculty.mun.ca/dbignell/ Dr. Dawn Bignell]

[https://sites.wustl.edu/blodgettlab/ Prof. Joshua Blodgett]

[https://blogs.cornell.edu/buckley/ Prof. Dan Buckley]

[https://www.jic.ac.uk/people/mark-buttner/ Prof. Mark Buttner]

Prof. Beatriz Cámara

[https://warwick.ac.uk/fac/sci/chemistry/research/challis/challisgroup Prof. Greg Challis]

[http://www.claessen-lab.nl/ Prof. Dennis Claessen]

[https://www.lerner.ccf.org/cms/claesen/ Prof. Jan Claesen]

[https://www.corre-lab.com/ Prof. Chris Corre]

[https://www.proimi.org.ar/miembros/dr-jose-sebastian-davila-costa Dr. José Sebastián Davila Costa]

[https://www.abdn.ac.uk/ncs/profiles/h.deng Dr. Hai Deng]

[http://skmml.sjtu.edu.cn/en/Faculty_Content.aspx?id=43 Prof. Zixin Deng] *

[http://publish.ucc.ie/researchprofiles/D021/adobson Prof. Alan Dobson]

Prof. Cristina Dorador

[http://www.naicons.com/about-us/management-team/stefano-donadio.html Dr. Stefano Donadio] *

[https://www.strath.ac.uk/staff/duncankatherinedr/ Dr. Kate Duncan]

[https://www.abdn.ac.uk/ncs/people/ncs/profiles/r.ebel Dr. Rainer Ebel]

[https://fhs.mcmaster.ca/biochem/elliot_marie.html Prof. Marie Elliot]

[https://eustaquio.lab.uic.edu Dr. Alessandra Eustaquio]

[http://scrippsscholars.ucsd.edu/wfenical Prof. William Fenical]

[https://www.biology.lu.se/klas-flardh Prof. Klas Flärdh]

[https://www.abdn.ac.uk/ncs/profiles/m.jaspars/ Prof. Marcel Jaspars]

[https://imbm.co.za/staff/dr-bronywn-kirby/ Dr. Bronwyn Kirby-McCullough]

Prof. Luis Maldonado

[http://www.uniovi.es/en/-/manteca-fernandez-angel Prof. Angel Manteca]

[https://www.edgehill.ac.uk/biology/staff/lorena-fernandez-martinez/ Dr. Lorena Fernández-Martínez]

[https://www.flinders.edu.au/people/chris.franco Prof. Chris Franco] *

[https://www.strath.ac.uk/staff/herronpauldr/ Dr. Paul Herron]

[https://www.strath.ac.uk/staff/hoskissonpauldr/ Prof. Paul Hoskisson] *

[https://www.geomar.de/en/mitarbeiter/fb3/ms/uhentschel/ Prof. Ute Hentschel]

[https://people.uea.ac.uk/m_hutchings Prof. Matt Hutchings]

[http://www.ibmb.uni.wroc.pl/zmm/jakimowicz.html Prof. Dagmara Jakimowicz]

[http://scrippsscholars.ucsd.edu/pjensen Prof. Paul Jensen]

[https://people.uea.ac.uk/g_kelemen Dr. Gabriela Kelemen]

[https://scholar.google.co.uk/citations?user=yL6B0g8AAAAJ Prof. Pierre Leblonde]

[https://www.unipa.it/persone/docenti/p/a.maria.puglia Prof. Anna Maria Puglia]

[http://loesgenlab.org/ Prof. Sandra Loesgen]

[https://pppmb.cals.cornell.edu/people/rosemary-loria/ Prof. Rose Loria] *

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/mast/ Dr. Yvonne Mast]

[https://www.duq.edu/academics/faculty/joseph-mccormick Prof. Joe McCormick]

[https://chemistry.illinois.edu/douglasm Prof. Douglas Mitchell]

[http://scrippsscholars.ucsd.edu/bsmoore/pages/moore-lab-research Prof. Bradley Moore]

[https://jgi.doe.gov/about-us/organization/strategic-management/nigel-mouncey/ Dr. Nigel Mouncey]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-einrichtungen/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/musiol-kroll/ Dr. Ewa Musiol-Kroll]

[https://uni-tuebingen.de/en/faculties/faculty-of-science/departments/interfaculty-facilities/imit/research-groups/microbiology-biotechnology/research-groups/muth/ Dr. Gunter Muth]

[http://biochemistry.utoronto.ca/person/justin-r-nodwell/ Prof. Justin Nodwell] *

[http://www.sussex.ac.uk/profiles/117009 Dr. Mark Paget]

[https://micro.biol.ethz.ch/research/piel.html Prof. Jorn Piel]

[http://biosci.snu.ac.kr/en/people/faculty?mode=view&profidx=13 Prof. Jung-Hye Roe] *

[http://cput.academia.edu/MarilizeLeRoesHill Dr. Marilize Le Roes-Hill]

Prof. Richard Samuels

[https://pharmacy.uic.edu/profiles/sanchelm/ Dr. Laura Sanchez]

[https://www.northumbria.ac.uk/about-us/our-staff/s/dr-vartul-sangal/ Dr. Vartul Sangal]

[https://www.biologie.uni-halle.de/microbiology/sawers/ Prof. Gary Sawers]

[https://www.schlimpertlab.com Dr. Susan Schlimpert]

[https://biologicalsciences.leeds.ac.uk/molecular-and-cellular-biology/staff/134/dr-ryan-f-seipke Dr. Ryan Seipke]

[https://www.york.ac.uk/biology/research/molecular-microbiology/maggie-smith/ Prof. Maggie Smith]

[https://research.brighton.ac.uk/en/persons/colin-smith Prof. Colin Smith]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-institute-und-zentren/imit/arbeitsgruppen/mikrobiologie-biotechnologie/research-groups/stegmann/ Dr. Evi Stegmann]

[https://biochemistry.tamu.edu/people/straight-paul/ Dr. Paul Straight]

[https://www.northumbria.ac.uk/about-us/our-staff/s/professor-iain-sutcliffe/ Prof. Iain Sutcliffe]

[https://www.faculty.mun.ca/ktahlan/ Dr. Kapil Tahlan]

[https://www.research.manchester.ac.uk/portal/eriko.takano.html Prof. Eriko Takano]

[https://www.biologie.hu-berlin.de/de/gruppenseiten/mikrobiologie/tschowri_group Dr. Natalia Tschowri]

[https://scholar.google.co.th/citations?user=xj8zuvoAAAAJ&hl=th Prof. Arinthip Thamchaipenet] *

[https://people.csiro.au/T/L/Louise-Thatcher Dr. Louise Thatcher]

[https://plantandmicrobiology.berkeley.edu/profile/traxler Dr. Matt Traxler]

[https://scholar.google.es/citations?user=t4UxSxEAAAAJ&hl=en Dr. Martha Trujillo] *

[https://www.jic.ac.uk/people/andrew-truman/ Dr. Andy Truman]

Dr. Kenji Ueda *

[https://www.swansea.ac.uk/staff/medicine/learningandteaching/vankeuleng/ Dr. Geertje van Keulen]

[https://www.universiteitleiden.nl/en/staffmembers/gilles-van-wezel#tab-1 Prof. Gilles van Wezel] *

[https://www.irb.hr/eng/About-RBI/People/Dusica-Vujaklija Dr. Dusica Vujaklija]

[https://warwick.ac.uk/fac/sci/lifesci/people/ewellington/ Prof. Liz Wellington] *

[https://www.jic.ac.uk/people/professor-barrie-wilkinson/ Prof. Barrie Wilkinson]

[https://uni-tuebingen.de/fakultaeten/mathematisch-naturwissenschaftliche-fakultaet/fachbereiche/interfakultaere-institute-und-zentren/imit/arbeitsgruppen/mikrobiologie-biotechnologie/ Prof. Wolfgang Wohlleben] *

[http://www.thewrightlab.com Prof. Gerry Wright]

[http://www.ibmb.uni.wroc.pl/zmm/zakrzewska.html Dr. Jolanta Zakrzewska-Czerwińska]

[http://zhanglab.caspmi.cn/?people/current-members/zhanglixin.html Prof. Lixin Zhang] *

[https://uni-tuebingen.de/en/faculties/faculty-of-science/departments/interfaculty-institutes-and-centres/imit/research-groups/applied-natural-products-genome-mining/ Prof. Nadine Ziemert]

PIJ10257

2019-08-13T14:45:15Z

Alicia: /* Features */

{{DISPLAYTITLE: pIJ10257}}

==Use==

This vector can be used to introduce a gene or set of genes from E. coli into Streptomyces , to be put under the control of the constitutive ermE* promoter. This can be useful for over expression or complementation experiments.

==Features==

* Hygromycin resistance gene
* ermE* promoter
* ΦBT1 phage integration site
*Origin of transfer oriT from RK2

==History==

Backbone vector pMS81 was modified by cloning in a 330 bp fragment containing ermE*, a ribosome binding site and a multicloning site isolated from pIJ8723, to create pIJ102571.

==Map==

[[File: PIJ10257 Map2.png]]

==Sequence links==

==References==

# Hong, H., Hutchings, M. I., Hill, L. M., Buttner, M. J. (2005). The Role of the Novel Fem Protein VanK in Vancomycin Resistance in Streptomyces coelicolor. ''Journal of Biological Chemistry'', 280, pp. 13055-13061. doi: 10.1074/jbc.M413801200

PKC1132

2019-08-13T14:24:41Z

Alicia: /* Use */

{{DISPLAYTITLE: pKC1132}}

==Use==

pKC1132 is a suicide vector that can be used for cloning and homologous recombination experiments such as gene deletions and disruptions. It is a conjugative, non-integrative plasmid that can be used to make constructs in E. coli that can be transferred by conjugation into Streptomyces species.1 It also contains a lacZa gene to allow for blue/white screening of recombinant clones in E. coli.

==Features==
*Apramycin resistance
*Origin of transfer oriT from RK2
*Multiple cloning site within lacZa to allow for screening of recombinant clones

==History==

pKC1132 is a derivative of pOJ260 with a deletion between the KpnI to SpeI sites.1

==Map==
[[File:PKC1132 Map.png]]

==Sequence links==

==References==

1. Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R. and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43-49

PKC1132

2019-08-13T14:24:19Z

Alicia: /* Use */

{{DISPLAYTITLE: pKC1132}}

==Use==

pKC1132 is a suicide vector that can be used for cloning and homologous recombination experiments such as gene deletions and disruptions. It is a conjugative, non-integrative plasmid that can be used to make constructs in E. coli that can be transferred by conjugation into Streptomyces species.1. It also contains a lacZa gene to allow for blue/white screening of recombinant clones in E. coli.

==Features==
*Apramycin resistance
*Origin of transfer oriT from RK2
*Multiple cloning site within lacZa to allow for screening of recombinant clones

==History==

pKC1132 is a derivative of pOJ260 with a deletion between the KpnI to SpeI sites.1

==Map==
[[File:PKC1132 Map.png]]

==Sequence links==

==References==

1. Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R. and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43-49

PKC1132

2019-08-13T14:23:01Z

Alicia: /* Features */

{{DISPLAYTITLE: pKC1132}}

==Use==

pKC1132 is a suicide vector that can be used for cloning and homologous recombination experiments such as gene deletions and disruptions. It is a conjugative, non-integrative plasmid that can be used to make constructs in E. coli that can be transferred by conjugation into Streptomyces species.1

==Features==
*Apramycin resistance
*Origin of transfer oriT from RK2
*Multiple cloning site within lacZa to allow for screening of recombinant clones

==History==

pKC1132 is a derivative of pOJ260 with a deletion between the KpnI to SpeI sites.1

==Map==
[[File:PKC1132 Map.png]]

==Sequence links==

==References==

1. Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R. and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43-49

PKC1132

2019-08-13T14:19:27Z

Alicia: /* Use */

{{DISPLAYTITLE: pKC1132}}

==Use==

pKC1132 is a suicide vector that can be used for cloning and homologous recombination experiments such as gene deletions and disruptions. It is a conjugative, non-integrative plasmid that can be used to make constructs in E. coli that can be transferred by conjugation into Streptomyces species.1

==Features==
*Apramycin resistance
*Origin of transfer oriT from RK2
*Multiple cloning site within lacZa to allow for detection of recombinant clones

==History==

pKC1132 is a derivative of pOJ260 with a deletion between the KpnI to SpeI sites.1

==Map==
[[File:PKC1132 Map.png]]

==Sequence links==

==References==

1. Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R. and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43-49

PKC1132

2019-08-13T14:18:42Z

Alicia: /* References */

{{DISPLAYTITLE: pKC1132}}

==Use==

pKC1132 is a suicide vector that can be used for cloning and homologous recombination experiments such as gene deletions and disruptions. It is a conjugative, non-integrative plasmid that can be used to make constructs in E. coli that can be transferred by conjugation into Streptomyces species.

==Features==
*Apramycin resistance
*Origin of transfer oriT from RK2
*Multiple cloning site within lacZa to allow for detection of recombinant clones

==History==

pKC1132 is a derivative of pOJ260 with a deletion between the KpnI to SpeI sites.1

==Map==
[[File:PKC1132 Map.png]]

==Sequence links==

==References==

1. Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R. and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43-49

PKC1132

2019-08-13T14:18:24Z

Alicia: /* References */

{{DISPLAYTITLE: pKC1132}}

==Use==

pKC1132 is a suicide vector that can be used for cloning and homologous recombination experiments such as gene deletions and disruptions. It is a conjugative, non-integrative plasmid that can be used to make constructs in E. coli that can be transferred by conjugation into Streptomyces species.

==Features==
*Apramycin resistance
*Origin of transfer oriT from RK2
*Multiple cloning site within lacZa to allow for detection of recombinant clones

==History==

pKC1132 is a derivative of pOJ260 with a deletion between the KpnI to SpeI sites.1

==Map==
[[File:PKC1132 Map.png]]

==Sequence links==

==References==

Bierman, M., Logan, R., O'Brien, K., Seno, E.T., Nagaraja Rao, R. and Schoner, B.E. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116, 43-49

PKC1132

2019-08-13T14:15:20Z

Alicia: /* History */

PKC1132

2019-08-13T14:13:32Z

Alicia: /* Features */