ActinoBase - User contributions [en-gb]

CUBIC

2024-01-23T14:35:52Z

Gilles: /* Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid */

=CUBIC=
CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

[https://pubs.acs.org/doi/10.1021/acssynbio.3c00464 CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces]

[https://www.addgene.org/210387/ pCB-1]

[https://www.addgene.org/210388/ pCB-2]

==Organisms==

CUBIC has been confirmed to work for the following species:

*[[Streptomyces coelicolor]]
*[[Streptomyces lividans]]
*[[Streptomyces venezuelae]]
*[[Streptomyces avermitillis]]
*[[Streptomyces roseosporus]]
*[[Streptomyces roseifaciens]]

==gRNA design using Geneious Prime==

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

==Preparation of double-stranded gRNA oligonucleotides==

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

Note: To facilitate the extensive construction of a CRISPRi library, the quantity of T4 Polynucleotide Kinase can be minimized to one-tenth of the original amount.

==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA. Not doing so is expected to result in a cloning efficiency of gRNA at approximately 90%.

Note: To facilitate the extensive construction of a CRISPRi library, both the quantity of BsaI-HF®v2 and T4 DNA Ligase can be minimized to one-tenth of the original amount.

==Transformation of CUBIC plasmids into E. coli==

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Select for correct colony and plasmid mini-prep==

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

==Transformation of CUBIC plasmids into non-methylating E. coli==

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.

CUBIC

2024-01-23T14:28:22Z

Gilles: /* Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid */

=CUBIC=
CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

[https://pubs.acs.org/doi/10.1021/acssynbio.3c00464 CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces]

[https://www.addgene.org/210387/ pCB-1]

[https://www.addgene.org/210388/ pCB-2]

==Organisms==

CUBIC has been confirmed to work for the following species:

*[[Streptomyces coelicolor]]
*[[Streptomyces lividans]]
*[[Streptomyces venezuelae]]
*[[Streptomyces avermitillis]]
*[[Streptomyces roseosporus]]
*[[Streptomyces roseifaciens]]

==gRNA design using Geneious Prime==

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

==Preparation of double-stranded gRNA oligonucleotides==

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

Note: To facilitate the extensive construction of a CRISPRi library, the quantity of T4 Polynucleotide Kinase can be minimized to one-tenth of the original amount.

==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

Note1: To facilitate the extensive construction of a CRISPRi library, both the quantity of BsaI-HF®v2 and T4 DNA Ligase can be minimized to one-tenth of the original amount.

==Transformation of CUBIC plasmids into E. coli==

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Select for correct colony and plasmid mini-prep==

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

==Transformation of CUBIC plasmids into non-methylating E. coli==

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.

CUBIC

2024-01-23T14:27:24Z

Gilles: /* Preparation of double-stranded gRNA oligonucleotides */

=CUBIC=
CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

[https://pubs.acs.org/doi/10.1021/acssynbio.3c00464 CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces]

[https://www.addgene.org/210387/ pCB-1]

[https://www.addgene.org/210388/ pCB-2]

==Organisms==

CUBIC has been confirmed to work for the following species:

*[[Streptomyces coelicolor]]
*[[Streptomyces lividans]]
*[[Streptomyces venezuelae]]
*[[Streptomyces avermitillis]]
*[[Streptomyces roseosporus]]
*[[Streptomyces roseifaciens]]

==gRNA design using Geneious Prime==

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

==Preparation of double-stranded gRNA oligonucleotides==

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

Note: To facilitate the extensive construction of a CRISPRi library, the quantity of T4 Polynucleotide Kinase can be minimized to one-tenth of the original amount.

==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

==Transformation of CUBIC plasmids into E. coli==

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Select for correct colony and plasmid mini-prep==

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

==Transformation of CUBIC plasmids into non-methylating E. coli==

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.

CUBIC

2024-01-23T13:25:22Z

Gilles:

=CUBIC=
CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

[https://pubs.acs.org/doi/10.1021/acssynbio.3c00464 CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces]

[https://www.addgene.org/210387/ pCB-1]

[https://www.addgene.org/210388/ pCB-2]

==Organisms==

CUBIC has been confirmed to work for the following species:

*[[Streptomyces coelicolor]]
*[[Streptomyces lividans]]
*[[Streptomyces venezuelae]]
*[[Streptomyces avermitillis]]
*[[Streptomyces roseosporus]]
*[[Streptomyces roseifaciens]]

==gRNA design using Geneious Prime==

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

==Preparation of double-stranded gRNA oligonucleotides==

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

==Transformation of CUBIC plasmids into E. coli==

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Select for correct colony and plasmid mini-prep==

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

==Transformation of CUBIC plasmids into non-methylating E. coli==

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.

CUBIC

2024-01-23T13:21:21Z

Gilles: /* CUBIC */

=CUBIC=
CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

[https://pubs.acs.org/doi/10.1021/acssynbio.3c00464 CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces]

[https://www.addgene.org/210387/ pCB-1]

[https://www.addgene.org/210388/ PCB-2]

==Organisms==

CUBIC has been confirmed to work for the following species:

*[[Streptomyces coelicolor]]
*[[Streptomyces lividans]]
*[[Streptomyces venezuelae]]
*[[Streptomyces avermitillis]]
*[[Streptomyces roseosporus]]
*[[Streptomyces roseifaciens]]

==gRNA design using Geneious Prime==

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

==Preparation of double-stranded gRNA oligonucleotides==

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

==Transformation of CUBIC plasmids into E. coli==

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Select for correct colony and plasmid mini-prep==

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

==Transformation of CUBIC plasmids into non-methylating E. coli==

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.

CUBIC

2024-01-22T21:09:39Z

Gilles: Created page with "=CUBIC= CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces. Click the link to find out more: CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces pCB-1 PCB-2 ==Organisms== CUBIC has been confirmed to work for the following species: *Streptomyces coelicolor *Streptomyces lividans *Streptomyces venezuelae *Streptomyc..."

=CUBIC=
CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces

pCB-1

PCB-2

==Organisms==

CUBIC has been confirmed to work for the following species:

*[[Streptomyces coelicolor]]
*[[Streptomyces lividans]]
*[[Streptomyces venezuelae]]
*[[Streptomyces avermitillis]]
*[[Streptomyces roseosporus]]
*[[Streptomyces roseifaciens]]

==gRNA design using Geneious Prime==

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

==Preparation of double-stranded gRNA oligonucleotides==

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

==Transformation of CUBIC plasmids into E. coli==

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Select for correct colony and plasmid mini-prep==

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

==Transformation of CUBIC plasmids into non-methylating E. coli==

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.

Protocols

2024-01-22T21:01:23Z

Gilles: /* Mutagenesis */

[[File:Actinobase-icons-trans_Protocols.png|150px|Protocols|link=Protocols]]

=Protocols organised by category=

==[[Bacteriophage]]==

*[[Streptomyces Bacteriophage plaque assay]]

*[[High titre preparation of phage]]

*[[Isolation of phages from single plaques]]

*[[Isolation of phages from environmental samples]]

==[[Biochemistry]]==

*[[GUS assay]] (β-Glucuronidase assay)

==Microbiology==

*[[Characterisation of Actinomycetes | General Characterisaton of Actinomycetes]]

*[[Conjugation using ET12567/pUZ8002]]

*[[Exploration | ''Streptomyces'' Exploration]]

*[[General Growth and Maintenance of Streptomyces sp.]]

*[[Isolating Actinomycetes from the environment]]

For a comprehensive guide to actinomycete characterisation see the [https://www.dsmz.de/collection/catalogue/microorganisms/special-groups-of-organisms/compendium-of-actinobacteria Compendium of Actinobacteria] from [https://www.helmholtz-hzi.de/en/research/research-topics/anti-infectives/microbial-strain-collection/our-research/#anchorsection Prof. Joachim Wink] at the German Collection of Microorganisms & Cell Cultures ([https://www.dsmz.de/ DSMZ]). This resouce provides protocols for characterising a wide range of features for new isolates, but may also be applicable more broadly for example for phenotyping experiments. The tests include colony morphology, melanin production, salt tolerance, carbon utlilisation and much more. To download the guide please see the link below.

[https://actinobase.org/downloads/DSMZ.pdf DSMZ Compendium of Actinobacteria]

==[[Plant-Microbe interactions]]==

* See [[Plant-Microbe interactions|main section]] for full list of protocols

==[[Microscopy]]==

*[[Staining of ''Streptomyces'' spp. Cell Wall and Nucleic Acids| Staining of ''Streptomyces'' spp. Cell Wall and Nucleic Acids]]

*[[Cultivating Actinobacteria for Microscopic Analysis]]

==[[Mutagenesis]]==

*[[CRISPR/Cas9-mediated genome editing]]

*[[Chemical mutagenesis]]

*[[CUBIC]]

*[[Depletion strains]]

*[[Lambda-red mediated recombination (PCR-targeting system a.k.a. "Redirect")]]

*[[Lambda-red mediated recombination using ssDNA]]

*[[Meganuclease I-SceI based system for gene deletions]]

*[[Protoplasts Formation, Regeneration and Transformation]]

*[["Quikchange" site-directed mutagenesis]]

*[[Random mutagenesis using a mutator strain]]

*[[Random mutagenesis using error-prone PCR]]

*[[Suicide vectors]]

*[[Transposons]]

*[[UV mutagenesis]]

==[[Natural Products]]==

*[[Cloning, Transformation and Expression of Gene Clusters]]

*[[Metabolite extractions]]

*[[Production of microbial volatile organic compounds]]

==[[Next Generation Sequencing]]==

*[[ChIP Sequencing]]
*[[ChIP-exo sequencing]]
https://www.nature.com/articles/s41467-018-05265-7/
*[[RNA Sequencing]]
*[[rRNA depletion with Streptomyces coelicolor A3(2) specific probes]]
*[[Differential RNA sequencing]]

==[[Nucleic Acid Methods]]==

*[[Codon Optimising Sequences for Heterologous Expression in Streptomyces]]

*[[High GC PCR]]

*[[RNA extraction from Actinobacteria]]

*[[RNA interference]]

*[[Salting Out Genomic DNA Extraction Method]]

*[[Southern Blotting]]

==[[Protein Methods]]==

*[[Isolating extracellular protein from Streptomyces]]

=Alphabetical list of protocols=

[[Characterisation of Actinomycetes]]

[[Cloning, Transformation and Expression of Gene Clusters]]

[[CRISPR/Cas9-mediated genome editing]]

[[Chemical mutagenesis]]

[[ChIP Seq]]

[[Codon Optimising Sequences for Heterologous Expression in Streptomyces]]

[[Conjugation using ET12567/pUZ8002]]

[[Depletion strains]]

[[Exploration | ''Streptomyces'' Exploration]]

[[General Growth and Maintenance of Streptomyces sp.]]

[[GUS assay]] (β-Glucuronidase assay)

[[High GC PCR]]

[[High titre preparation of phage]]

[[Isolating Actinomycetes from the environment]]

[[Isolating extracellular protein from Streptomyces]]

[[Isolating Streptomyces from plant roots]]

[[Isolation of phages from environmental samples]]

[[Isolation of phages from single plaques]]

[[Lambda-red mediated recombination (PCR-targeting system a.k.a. "Redirect")]]

[[Lambda-red mediated recombination using ssDNA]]

[[Meganuclease I-SceI based system for gene deletions]]

[[Metabolite extractions]]

[[Protoplasts Formation, Regeneration and Transformation]]

[["Quikchange" site-directed mutagenesis]]

[[Random mutagenesis using a mutator strain]]

[[Random mutagenesis using error-prone PCR]]

[[RNA extraction from Actinobacteria]]

[[Salting Out Genomic DNA Extraction Method]]

[[Southern Blotting]]

[[Staining of ''Streptomyces'' spp. Cell Wall and Nucleic Acids| Staining of ''Streptomyces'' spp. Cell Wall and Nucleic Acids]]

[[Streptomyces Bacteriophage plaque assay]]

[[Suicide vectors]]

[[Transposons]]

[[UV mutagenesis]]