ActinoBase - User contributions [en-gb]

ChIP Seq

2019-08-03T09:36:05Z

HeeeenaJ: /* Protocol */

==Summary==

==Protocol==

Buffers:-
IP Buffer
50 mM HEPES pH to 7.5 with KOH
150 mM NaCl
1 mM EDTA
1 % Triton X-100
0.1 % Sodium deoxycholate
0.1 % SDS

5X Elution Buffer
TE pH 7.6
5% SDS

IP Buffer + salt
50 mM HEPES pH to 7.5 with KOH
500 mM NaCl
1 mM EDTA
1 % Triton X-100
0.1 % Sodium deoxycholate
0.1 % SDS

Wash Buffer
10 mM Tris pH 8.0
250 mM LiCl
1 mM EDTA
0.5 % Nonidet P-40 substitute
0.5 % Sodium deoxycholate

1X Elution Buffer
TE pH 7.6
1 % SDS

Pre-germination:
1) Normalise the spores, for multiple samples
2) Add the spores to 1 ml TES buffer, centrifuge and remove the supernatant, re-suspend in 1 ml TES buffer
3) Heat shock at 50˚C for 10 minutes
4) Add spores to 5 ml 2X PG media + 10 µl 5 M CaCl2 and leave at 37˚C for 3 hours
5) Vortex vigorously
6) Add spores to media, typically 3 ml into 2 flasks of 80 ml YEME (10% glucose) + 160 µl MgCl2 and 80 µl 10% antifoam
7) Leave shaking overnight at 300 rpm, 30˚C

8) Wait until the cultures are at OD600 = 0.8-1

Cross-linking:
9) Add 1% formaldehyde and place back in 30˚C, 300 rpm for 20 min
10) Add 0.05 M glycine and incubate for a further 5 min
11) Harvest cells by centrifugation @ 6000 rpm for 5 min @ 4˚C
12) Wash cells twice with 25 ml ice-cold PBS (pH 7.4)
13) Store pellet @ -80˚C

Chromatin extraction:
1) Label the bead beater cups (and corresponding lids) with marker pen & place in -80°C freezer for 1-2 hrs minimum before the extraction.
2) Add a frozen cell pellet straight from the -80°C freezer to each cup (two cups): Add the ball-bearing on top of the frozen pellet and screw on the lid & immerse in Liquid Nitrogen.
3) Place both cups (need 2 for balance) in machine and grind for 1 min 30 sec at a frequency of 30 Hz (maximum setting). You should hear a loud noise with a lot of fast metallic “clicking” if the ball-bearing is moving freely.
4) Repeat the cooling & grinding steps again for a total of 3 rounds. The pellet should have been reduced to a fine, friable, dry looking powder without any lumps. Place one of the cups in the - 80°C freezer to keep it cold whilst you process the other cup.
4) Remove lid, and remove ball bearing using a magnet (scrapping off powder from ball bearing if necessary). Scrape powder into a 15 ml centrifuge tube.

Extracting Chromatin:
1) Add 2.2 ml IP buffer (to a pellet from a 40 ml initial culture) containing RNAse A (0.1 mg/ml) + Protease Inhibitor tablet
2) Divide each 15 ml tube into 6 x 400 µl aliquots & sonicate using a Biorupter for 35 cycles with 30s ON & 30s OFF.
3) Spin all samples at 16,000 x g for 15 min.
4) Transfer supernatant to new tubes (6 x 400 µl aliquots]. This is your chromatin prep
5) Take 14 µl of each sample + 4 µl of 5 x Elution Buffer (TE pH 7.6, 5% SDS) + 1 µl of RNAse (stock 1 mg/ml) & leave at RT for 30 min. Put all of this in a PCR tube.
6) Freeze remainder of supernatant (380l) at -20⁰C.
7) Add 2 µl of Proteinase K (stock: 10 mg/ml) & leave at 42⁰C for 2 hrs.
8) De-cross link at 65⁰C for ~ 6 hrs (overnight in PCR machine).
9) Next day run 5 μl aliquots on a gel with orange loading dye on 1.2% agarose gel to check fragment sizes.
10) Check sample fragment sizes most closely matche the ideal size range of between 50-500 bp for future work. Sonicate further if needed.

Chromatin Immunoprecipitation:
1) Take samples from freezer and place in 2 ml Eppendorf tube. Pre-clear the chromatin samples by adding 25 μl of NEB Protein G or Protein A magnetic beads depending on what antibodies will be used.
2) Incubate the chromatin and beads at 4°C (cold room) for 1.5 hour in a rotator set to 20 rpm. This step allows any material in the chromatin prep which non-specifically adheres to the beads to bind and be removed prior to the immunoprecipitation
3) After the incubation immobilise the beads using a magnetic rack and transfer the liquid (cleared chromatin) to a fresh labelled tube.
4) Take 100 μl of pre-cleared chromatin (input control sample) & freeze at -20⁰C until IP are ready for de-crosslinking.
5) To remaining chromatin material add the antibody to your protein of interest (1-5 μg) to the cleared chromatin. Use 7 μl of the antibody (stock: 1mg/ml) and incubate at 2.5 hrs at 4°C (cold room) in a rotator set to 20 rpm.
6) Add 30 μl of Protein G or A magnetic beads to the chromatin and antibody and leave for 1.5 hr in the 4°C (cold room) in a rotator set to 20 rpm.
7) Immobilise the beads using a magnetic rack and remove (and keep) the spent chromatin liquid
8) Re-suspend the beads by gentle pipetting (do not vortex) in 750 μl of ice-cold IP buffer. Transfer the re-suspended beads to a new non-stick 1.5 ml tube (Ambion/Fisher cat no VYAM12450) and do the washes.
9) Washes: incubate the re-suspended beads in IP Buffer at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Then immobilise the beads using a magnetic rack and discard the IP Buffer.
10) Re-suspend the beads in 1 ml of ice-cold IP Buffer + Salt and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Again immobilise the beads using a magnetic rack and discard the IP Buffer + Salt.
11) Re-suspend the beads in 1 ml of ice-cold IP Wash Buffer and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Immobilise the beads using a magnetic rack and discard the IP Wash Buffer .
12) Re-suspend the beads in 1 ml of ice-cold TE pH 8 and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Immobilise the beads using a magnetic rack and discard the TE pH 8. Repeat this step.
13) Re-suspend the beads in 100 μl of 1 x Elution Buffer and add 5 μl of RNAse A (stock: 1mg/ml) & leave @ RT for 30min.
14) Take out the 100 μl of input control chromatin & add 5 μl of RNAse A (stock: 1mg/ml) & leave @ RT for 30min.
15) To the IP & input: de-crosslink by heating to 65°C waterbath overnight.
16) Next day, Immobilise the beads using a magnetic rack and transfer the liquid which contains the immunoprecipitated DNA to a fresh labelled tube.
17) Re-suspend the beads in 50 μl of TE pH 7.5 to wash any remaining DNA from them. Immobilise the beads using a magnetic rack and transfer the 50 μl of TE pH 7.5 to the other immunoprecipitated DNA solution.
18) Add 50 μl TE to the total input control DNA sample so that all samples are 150 μl.
19) Add 5 μl of 10 mg/ml Proteinase K & incubate at 55°C for 2 hrs in the waterbath. This step destroys the proteins.
20) To Both IP & input:
-Pass the samples through a PCR purification column (Qiagen kit – MiniElute Kit is recommended).
-Nanodrop 1.5 μl.

ChIP Seq

2019-08-03T09:35:53Z

HeeeenaJ: Replaced content with "==Summary== ==Protocol=="

==Summary==

==Protocol==

ChIP Seq

2019-08-03T09:35:24Z

HeeeenaJ: /* Summary */

ChIP Seq

2019-08-03T09:35:00Z

HeeeenaJ:

==Summary==

Buffers:-
IP Buffer
50 mM HEPES pH to 7.5 with KOH
150 mM NaCl
1 mM EDTA
1 % Triton X-100
0.1 % Sodium deoxycholate
0.1 % SDS

5X Elution Buffer
TE pH 7.6
5% SDS

IP Buffer + salt
50 mM HEPES pH to 7.5 with KOH
500 mM NaCl
1 mM EDTA
1 % Triton X-100
0.1 % Sodium deoxycholate
0.1 % SDS

Wash Buffer
10 mM Tris pH 8.0
250 mM LiCl
1 mM EDTA
0.5 % Nonidet P-40 substitute
0.5 % Sodium deoxycholate

1X Elution Buffer
TE pH 7.6
1 % SDS

Pre-germination:
1) Normalise the spores, for multiple samples
2) Add the spores to 1 ml TES buffer, centrifuge and remove the supernatant, re-suspend in 1 ml TES buffer
3) Heat shock at 50˚C for 10 minutes
4) Add spores to 5 ml 2X PG media + 10 µl 5 M CaCl2 and leave at 37˚C for 3 hours
5) Vortex vigorously
6) Add spores to media, typically 3 ml into 2 flasks of 80 ml YEME (10% glucose) + 160 µl MgCl2 and 80 µl 10% antifoam
7) Leave shaking overnight at 300 rpm, 30˚C

8) Wait until the cultures are at OD600 = 0.8-1

Cross-linking:
9) Add 1% formaldehyde and place back in 30˚C, 300 rpm for 20 min
10) Add 0.05 M glycine and incubate for a further 5 min
11) Harvest cells by centrifugation @ 6000 rpm for 5 min @ 4˚C
12) Wash cells twice with 25 ml ice-cold PBS (pH 7.4)
13) Store pellet @ -80˚C

Chromatin extraction:
1) Label the bead beater cups (and corresponding lids) with marker pen & place in -80°C freezer for 1-2 hrs minimum before the extraction.
2) Add a frozen cell pellet straight from the -80°C freezer to each cup (two cups): Add the ball-bearing on top of the frozen pellet and screw on the lid & immerse in Liquid Nitrogen.
3) Place both cups (need 2 for balance) in machine and grind for 1 min 30 sec at a frequency of 30 Hz (maximum setting). You should hear a loud noise with a lot of fast metallic “clicking” if the ball-bearing is moving freely.
4) Repeat the cooling & grinding steps again for a total of 3 rounds. The pellet should have been reduced to a fine, friable, dry looking powder without any lumps. Place one of the cups in the - 80°C freezer to keep it cold whilst you process the other cup.
4) Remove lid, and remove ball bearing using a magnet (scrapping off powder from ball bearing if necessary). Scrape powder into a 15 ml centrifuge tube.

Extracting Chromatin:
1) Add 2.2 ml IP buffer (to a pellet from a 40 ml initial culture) containing RNAse A (0.1 mg/ml) + Protease Inhibitor tablet
2) Divide each 15 ml tube into 6 x 400 µl aliquots & sonicate using a Biorupter for 35 cycles with 30s ON & 30s OFF.
3) Spin all samples at 16,000 x g for 15 min.
4) Transfer supernatant to new tubes (6 x 400 µl aliquots]. This is your chromatin prep
5) Take 14 µl of each sample + 4 µl of 5 x Elution Buffer (TE pH 7.6, 5% SDS) + 1 µl of RNAse (stock 1 mg/ml) & leave at RT for 30 min. Put all of this in a PCR tube.
6) Freeze remainder of supernatant (380l) at -20⁰C.
7) Add 2 µl of Proteinase K (stock: 10 mg/ml) & leave at 42⁰C for 2 hrs.
8) De-cross link at 65⁰C for ~ 6 hrs (overnight in PCR machine).
9) Next day run 5 μl aliquots on a gel with orange loading dye on 1.2% agarose gel to check fragment sizes.
10) Check sample fragment sizes most closely matche the ideal size range of between 50-500 bp for future work. Sonicate further if needed.

Chromatin Immunoprecipitation:
1) Take samples from freezer and place in 2 ml Eppendorf tube. Pre-clear the chromatin samples by adding 25 μl of NEB Protein G or Protein A magnetic beads depending on what antibodies will be used.
2) Incubate the chromatin and beads at 4°C (cold room) for 1.5 hour in a rotator set to 20 rpm. This step allows any material in the chromatin prep which non-specifically adheres to the beads to bind and be removed prior to the immunoprecipitation
3) After the incubation immobilise the beads using a magnetic rack and transfer the liquid (cleared chromatin) to a fresh labelled tube.
4) Take 100 μl of pre-cleared chromatin (input control sample) & freeze at -20⁰C until IP are ready for de-crosslinking.
5) To remaining chromatin material add the antibody to your protein of interest (1-5 μg) to the cleared chromatin. Use 7 μl of the antibody (stock: 1mg/ml) and incubate at 2.5 hrs at 4°C (cold room) in a rotator set to 20 rpm.
6) Add 30 μl of Protein G or A magnetic beads to the chromatin and antibody and leave for 1.5 hr in the 4°C (cold room) in a rotator set to 20 rpm.
7) Immobilise the beads using a magnetic rack and remove (and keep) the spent chromatin liquid
8) Re-suspend the beads by gentle pipetting (do not vortex) in 750 μl of ice-cold IP buffer. Transfer the re-suspended beads to a new non-stick 1.5 ml tube (Ambion/Fisher cat no VYAM12450) and do the washes.
9) Washes: incubate the re-suspended beads in IP Buffer at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Then immobilise the beads using a magnetic rack and discard the IP Buffer.
10) Re-suspend the beads in 1 ml of ice-cold IP Buffer + Salt and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Again immobilise the beads using a magnetic rack and discard the IP Buffer + Salt.
11) Re-suspend the beads in 1 ml of ice-cold IP Wash Buffer and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Immobilise the beads using a magnetic rack and discard the IP Wash Buffer .
12) Re-suspend the beads in 1 ml of ice-cold TE pH 8 and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Immobilise the beads using a magnetic rack and discard the TE pH 8. Repeat this step.
13) Re-suspend the beads in 100 μl of 1 x Elution Buffer and add 5 μl of RNAse A (stock: 1mg/ml) & leave @ RT for 30min.
14) Take out the 100 μl of input control chromatin & add 5 μl of RNAse A (stock: 1mg/ml) & leave @ RT for 30min.
15) To the IP & input: de-crosslink by heating to 65°C waterbath overnight.
16) Next day, Immobilise the beads using a magnetic rack and transfer the liquid which contains the immunoprecipitated DNA to a fresh labelled tube.
17) Re-suspend the beads in 50 μl of TE pH 7.5 to wash any remaining DNA from them. Immobilise the beads using a magnetic rack and transfer the 50 μl of TE pH 7.5 to the other immunoprecipitated DNA solution.
18) Add 50 μl TE to the total input control DNA sample so that all samples are 150 μl.
19) Add 5 μl of 10 mg/ml Proteinase K & incubate at 55°C for 2 hrs in the waterbath. This step destroys the proteins.
20) To Both IP & input:
-Pass the samples through a PCR purification column (Qiagen kit – MiniElute Kit is recommended).
-Nanodrop 1.5 μl.

ChIP Seq

2019-08-03T09:34:24Z

HeeeenaJ: Created page with "Buffers:- IP Buffer 50 mM HEPES pH to 7.5 with KOH 150 mM NaCl 1 mM EDTA 1 % Triton X-100 0.1 % Sodium deoxycholate 0.1 % SDS 5X Elution Buffer TE pH 7.6 5% SDS IP Buffer +..."

Buffers:-
IP Buffer
50 mM HEPES pH to 7.5 with KOH
150 mM NaCl
1 mM EDTA
1 % Triton X-100
0.1 % Sodium deoxycholate
0.1 % SDS

5X Elution Buffer
TE pH 7.6
5% SDS

IP Buffer + salt
50 mM HEPES pH to 7.5 with KOH
500 mM NaCl
1 mM EDTA
1 % Triton X-100
0.1 % Sodium deoxycholate
0.1 % SDS

Wash Buffer
10 mM Tris pH 8.0
250 mM LiCl
1 mM EDTA
0.5 % Nonidet P-40 substitute
0.5 % Sodium deoxycholate

1X Elution Buffer
TE pH 7.6
1 % SDS

Pre-germination:
1) Normalise the spores, for multiple samples
2) Add the spores to 1 ml TES buffer, centrifuge and remove the supernatant, re-suspend in 1 ml TES buffer
3) Heat shock at 50˚C for 10 minutes
4) Add spores to 5 ml 2X PG media + 10 µl 5 M CaCl2 and leave at 37˚C for 3 hours
5) Vortex vigorously
6) Add spores to media, typically 3 ml into 2 flasks of 80 ml YEME (10% glucose) + 160 µl MgCl2 and 80 µl 10% antifoam
7) Leave shaking overnight at 300 rpm, 30˚C

8) Wait until the cultures are at OD600 = 0.8-1

Cross-linking:
9) Add 1% formaldehyde and place back in 30˚C, 300 rpm for 20 min
10) Add 0.05 M glycine and incubate for a further 5 min
11) Harvest cells by centrifugation @ 6000 rpm for 5 min @ 4˚C
12) Wash cells twice with 25 ml ice-cold PBS (pH 7.4)
13) Store pellet @ -80˚C

Chromatin extraction:
1) Label the bead beater cups (and corresponding lids) with marker pen & place in -80°C freezer for 1-2 hrs minimum before the extraction.
2) Add a frozen cell pellet straight from the -80°C freezer to each cup (two cups): Add the ball-bearing on top of the frozen pellet and screw on the lid & immerse in Liquid Nitrogen.
3) Place both cups (need 2 for balance) in machine and grind for 1 min 30 sec at a frequency of 30 Hz (maximum setting). You should hear a loud noise with a lot of fast metallic “clicking” if the ball-bearing is moving freely.
4) Repeat the cooling & grinding steps again for a total of 3 rounds. The pellet should have been reduced to a fine, friable, dry looking powder without any lumps. Place one of the cups in the - 80°C freezer to keep it cold whilst you process the other cup.
4) Remove lid, and remove ball bearing using a magnet (scrapping off powder from ball bearing if necessary). Scrape powder into a 15 ml centrifuge tube.

Extracting Chromatin:
1) Add 2.2 ml IP buffer (to a pellet from a 40 ml initial culture) containing RNAse A (0.1 mg/ml) + Protease Inhibitor tablet
2) Divide each 15 ml tube into 6 x 400 µl aliquots & sonicate using a Biorupter for 35 cycles with 30s ON & 30s OFF.
3) Spin all samples at 16,000 x g for 15 min.
4) Transfer supernatant to new tubes (6 x 400 µl aliquots]. This is your chromatin prep
5) Take 14 µl of each sample + 4 µl of 5 x Elution Buffer (TE pH 7.6, 5% SDS) + 1 µl of RNAse (stock 1 mg/ml) & leave at RT for 30 min. Put all of this in a PCR tube.
6) Freeze remainder of supernatant (380l) at -20⁰C.
7) Add 2 µl of Proteinase K (stock: 10 mg/ml) & leave at 42⁰C for 2 hrs.
8) De-cross link at 65⁰C for ~ 6 hrs (overnight in PCR machine).
9) Next day run 5 μl aliquots on a gel with orange loading dye on 1.2% agarose gel to check fragment sizes.
10) Check sample fragment sizes most closely matche the ideal size range of between 50-500 bp for future work. Sonicate further if needed.

Chromatin Immunoprecipitation:
1) Take samples from freezer and place in 2 ml Eppendorf tube. Pre-clear the chromatin samples by adding 25 μl of NEB Protein G or Protein A magnetic beads depending on what antibodies will be used.
2) Incubate the chromatin and beads at 4°C (cold room) for 1.5 hour in a rotator set to 20 rpm. This step allows any material in the chromatin prep which non-specifically adheres to the beads to bind and be removed prior to the immunoprecipitation
3) After the incubation immobilise the beads using a magnetic rack and transfer the liquid (cleared chromatin) to a fresh labelled tube.
4) Take 100 μl of pre-cleared chromatin (input control sample) & freeze at -20⁰C until IP are ready for de-crosslinking.
5) To remaining chromatin material add the antibody to your protein of interest (1-5 μg) to the cleared chromatin. Use 7 μl of the antibody (stock: 1mg/ml) and incubate at 2.5 hrs at 4°C (cold room) in a rotator set to 20 rpm.
6) Add 30 μl of Protein G or A magnetic beads to the chromatin and antibody and leave for 1.5 hr in the 4°C (cold room) in a rotator set to 20 rpm.
7) Immobilise the beads using a magnetic rack and remove (and keep) the spent chromatin liquid
8) Re-suspend the beads by gentle pipetting (do not vortex) in 750 μl of ice-cold IP buffer. Transfer the re-suspended beads to a new non-stick 1.5 ml tube (Ambion/Fisher cat no VYAM12450) and do the washes.
9) Washes: incubate the re-suspended beads in IP Buffer at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Then immobilise the beads using a magnetic rack and discard the IP Buffer.
10) Re-suspend the beads in 1 ml of ice-cold IP Buffer + Salt and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Again immobilise the beads using a magnetic rack and discard the IP Buffer + Salt.
11) Re-suspend the beads in 1 ml of ice-cold IP Wash Buffer and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Immobilise the beads using a magnetic rack and discard the IP Wash Buffer .
12) Re-suspend the beads in 1 ml of ice-cold TE pH 8 and again incubate at 4°C (cold room) for 10 min in a rotator set to 20 rpm. Immobilise the beads using a magnetic rack and discard the TE pH 8. Repeat this step.
13) Re-suspend the beads in 100 μl of 1 x Elution Buffer and add 5 μl of RNAse A (stock: 1mg/ml) & leave @ RT for 30min.
14) Take out the 100 μl of input control chromatin & add 5 μl of RNAse A (stock: 1mg/ml) & leave @ RT for 30min.
15) To the IP & input: de-crosslink by heating to 65°C waterbath overnight.
16) Next day, Immobilise the beads using a magnetic rack and transfer the liquid which contains the immunoprecipitated DNA to a fresh labelled tube.
17) Re-suspend the beads in 50 μl of TE pH 7.5 to wash any remaining DNA from them. Immobilise the beads using a magnetic rack and transfer the 50 μl of TE pH 7.5 to the other immunoprecipitated DNA solution.
18) Add 50 μl TE to the total input control DNA sample so that all samples are 150 μl.
19) Add 5 μl of 10 mg/ml Proteinase K & incubate at 55°C for 2 hrs in the waterbath. This step destroys the proteins.
20) To Both IP & input:
-Pass the samples through a PCR purification column (Qiagen kit – MiniElute Kit is recommended).
-Nanodrop 1.5 μl.

PIJ12738

2019-08-03T09:13:57Z

HeeeenaJ: /* Characteristics */

{{DISPLAYTITLE: pIJ12738}}

=pIJ12738=

==Background==

==Construction==

==Uses==
Selecting for gene deletions in actinomycetes

==Characteristics==

Contains the meganuclease I-SceI recognition site

Derivative of pGM1190, an intermediate copy number, conjugative plasmid containing the temperature-sensitive replication origin of pSG5

==Map and Sequence==

atctacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacctgatgcagctctcgcagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgttgatcggcactttgcatcggccgcgctcccgattccggaagtgcttgacattggggaatttatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgggctgcaggtcgactctagaggatccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatatcgagcttaccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagttagggataacagggtaatatcgaattcgtaatcatgtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggttcatgtgcagctccatcagcaaaaggggatgataagtttatcaccaccgactatttgcaacagtgccgttgatcgtgctatgatcgactgatgtcatcagcggtggagtgcaatgtcgtgcaatacgaatggcgaaaagccgagctcatcggtcagcttctcaaccttggggttacccccggcggtgtgctgctggtccacagctccttccgtagcgtccggcccctcgaagatgggccacttggactgatcgaggccctgcgtgctgcgctgggtccgggagggacgctcgtcatgccctcgtggtcaggtctggacgacgagccgttcgatcctgccacgtcgcccgttacaccggaccttggagttgtctctgacacattctggcgcctgccaaatgtaaagcgcagcgcccatccatttgcctttgcggcagcggggccacaggcagagcagatcatctctgatccattgcccctgccacctcactcgcctgcaagcccggtcgcccgtgtccatgaactcgatgggcaggtacttctcctcggcgtgggacacgatgccaacacgacgctgcatcttgccgagttgatggcaaaggttccctatggggtgccgagacactgcaccattcttcaggatggcaagttggtacgcgtcgattatctcgagaatgaccactgctgtgagcgctttgccttggcggacaggtggctcaaggagaagagccttcagaaggaaggtccagtcggtcatgcctttgctcggttgatccgctcccgcgacattgtggcgacagccctgggtcaactgggccgagatccgttgatcttcctgcatccgccagaggcgggatgcgaagaatgcgatgccgctcgccagtcgattggctgagctcatgagcggagaacgagatgacgttggaggggcaaggtcgcgctgattgctggggcaacacgtggagcggatcggggattgtctttcttcagctcgctgatgatatgctgacgctcaatgccgtttggcctccgactaacgaaaatcccgcatttggacggctgatccgattggcacggcggacggcgaatggcggagcagacgctcgtccgggggcaatgagatatgaaaaagcctgaactcaccgcgacgtatcgatgnnnntatgcaggtcgacggatcttttccgctgcataaccctgcttcggggtcattatagcgattttttcggtatatccatcctttttcgcacgatatacaggattttgccaaagggttcgtgtagactttccttggtgtatccaacggcgtcagccgggcaggataggtgaagtaggcccacccgcgagcgggtgttccttcttcactgtcccttattcgcacctggcggtgctcaacgggaatcctgctctgcgaggctggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgacttttttagccgctaaaacggccggggggtgcgcgtgattgccaagcacgtccccatgcgctccatcaagaagagcgacttcgcggagctggtgaagtacatcaccgacgagcaaggcaagaccgatccccggggacctgcatag

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

PIJ12742

2019-08-03T09:13:30Z

HeeeenaJ: /* Characteristics */

=pIJ12742=

==Background==

==Construction==

==Uses==
Selecting for gene deletions in actinomycetes

==Characteristics==

Contains the codon optimised I-SceI gene under the control of the strong constitutive ermE* promoter

Derivative of pGM1190, an intermediate copy number, conjugative plasmid containing the temperature-sensitive replication origin of pSG5

==Map and Sequence==

ggccgtcgacgacgacgcgtccgcctgcctgcttttggccggcgggccgggccgcggttgtccgccgggtcggaccggtcccttggtcgaccgatgcctcggccacgacgatgctgggcccgaagcggtacgcgaacccgtgccgggctgcggcggatcgcggcagcaggagctccccgcccgccacggctggctggatggtcgcctcacgcgcccgcaggggtgacggcgtgggtgcggcggtcagccccgtgatcgggcgtcagacggccgctgagggaccgcgaccacccctcccttcccgcctgccgtctttcaccgcccggccggtccgcagacgccgtacggccaggccacggaggattacgggcagatggcgcccacccggcacccgggctggggcaccctggacagcacgaaggcccgccccactcaccggggcgggccttcgcgttgagctagagttcccgccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaatgcagctcacggtaactgatgccgtatttgcagtaccagcgtacggcccacagaatgatgtcacgctgaaaatgccggcctttgaatgggttcatgtgcagctccatcagcaaaaggggatgataagtttatcaccaccgactatttgcaacagtgccgttgatcgtgctatgatcgactgatgtcatcagcggtggagtgcaatgtcgtgcaatacgaatggcgaaaagccgagctcatcggtcagcttctcaaccttggggttacccccggcggtgtgctgctggtccacagctccttccgtagcgtccggcccctcgaagatgggccacttggactgatcgaggccctgcgtgctgcgctgggtccgggagggacgctcgtcatgccctcgtggtcaggtctggacgacgagccgttcgatcctgccacgtcgcccgttacaccggaccttggagttgtctctgacacattctggcgcctgccaaatgtaaagcgcagcgcccatccatttgcctttgcggcagcggggccacaggcagagcagatcatctctgatccattgcccctgccacctcactcgcctgcaagcccggtcgcccgtgtccatgaactcgatgggcaggtacttctcctcggcgtgggacacgatgccaacacgacgctgcatcttgccgagttgatggcaaaggttccctatggggtgccgagacactgcaccattcttcaggatggcaagttggtacgcgtcgattatctcgagaatgaccactgctgtgagcgctttgccttggcggacaggtggctcaaggagaagagccttcagaaggaaggtccagtcggtcatgcctttgctcggttgatccgctcccgcgacattgtggcgacagccctgggtcaactgggccgagatccgttgatcttcctgcatccgccagaggcgggatgcgaagaatgcgatgccgctcgccagtcgattggctgagctcataagttcctattccgaagttcctattcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgaattgtacgtaggatccagcccgacccgagcacgcgccggcacgcctggtcgatgtcggaccggagttcgaggtacgcggcttgcaggtccaggaaggggacgtccatgcgagtgtccgttcgagtggcggcttgcgcccgatgctagtcgcggttgatcggcgatcgcaggtgcacgcggtcgatcttgacggctggcgagaggtgcggggaggatctgaccgacgcggtccacacgtggcaccgcgatgctgttgtgggcacaatcgtgccggttggtaggatcgtctagaacaggaggccccatatgcaccagaagaaccaggtcatgaacctgggcccgaactccaagctgctgaaggagtacaagtcccagctgatcgagctgaacatcgagcagttcgaggccggcatcggcctgatcctgggcgacgcctacatccgctcccgcgacgagggcaagacctactgcatgcagttcgagtggaagaacaaggcctacatggaccacgtctgcctgctgtacgaccagtgggtcctgtccccgccgcacaagaagcagcgcgtcaaccacctgggcaacctggtcatcacctggggcgcccagaccttcaagcaccaggccttcaacaagctggccaacctgttcatcgtcaacaacaagaagaccatcccgaacaacctggtcgagaactacctgaccccgatgtccctggcctactggttcatggacgacggcggcaagtgggactacaacaagaactccaccaacaagtccatcgtcctgaacacccagtccttcaccttcgaggaggtcgagtacctggtcaagggcctgcgcaacaagttccagctgaactgctacgtcaagatcaacaagaacaagccgatcatctacatcgactccatgtcctacctgatcttctacaacctgatcaagccgtacctgatcccgcagatgatgtacaagctgccgaacaccatctcctccgagaccttcctgaagtgataaaccgatacaattaaaggctccttttggagcctttttttttggagattttcaacgtgaaaaaattattattcgcaattccaacaaaaggctggagctccaccgcggccgcgcgcgatatcgaattccccagatctaaagttttgtcgtctttccagacgttagtaaatgaattttctgtatgaggttttgctaaacaactttcaacagtttcagcggagtgagaatagaaaggaacaactaaaggaattgcgaataataattttttcacgttgaaaatctccaaaaaaaaaggctccaaaaggagcctttaattgtatcggtttatcagcttgctttcgaggtgaatttcttaaacagcttgataccgatagttgcgccgacaatgacaacaaccatcgcccacgcataaccgatatattcggtcgctgaggcttgcagggagtcaaaggccgcttttgcgggatctcgtcgaaggcactagaaggcctatatgcggggatcgaccgcgcgggtcccggacggggaagagcggggagctttgccagagagcgacgacttccccttgcgttggtgattgccggtcagggcagccatccgccatcgtcgcgtagggtgtcacaccccaggaatcgcgtcactgaacacagcagccggtaggacgaccatgactgagttggacaccatcgcaaatccgtccgatcccgcggtgcagcggatcatcgatgtcaccaagccgtcgcgatccaacataaagacaacgttgatcgaggacgtcgagcccctcatgcacagcatcgcggccggggtggagttcatcgaggtctacggcagcgacagcagtccttttccatctgagttgctggatctgtgcgggcggcagaacataccggtccgcctcatcgactcctcgatcgtcaaccagttgttcaagggggagcggaaggccaagacattcggcatcgcccgcgtccctcgcccggccaggttcggcgatatcgcgagccggcgtggggacgtcgtcgttctcgacggggtgaagatcgtcgggaacatcggcgcgatagtacgcacgtcgctcgcgctcggagcgtcggggatcatcctggtcgacagtgacatcaccagcatcgcggaccggcgtctccaaagggccagccgaggttacgtcttctcccttcccgtcgttctctccggtcgcgaggaggccatcgccttcattcgggacagcggtatgcagctgatgacgctcaaggcggatggcgacatttccgtgaaggaactcggggacaatccggatcggctggccttgctgttcggcagcgaaaagggtgggccttccgacctgttcgaggaggcgtcttccgcctcggtttccatccccatgatgagccagaccgagtctctcaacgtttccgtttccctcggaatcgcgctgcacgagaggatcgacaggaatctcgcggccaaccgataagcgcctctgttcctcggacgctcggttcctcgacctcgattcgtcagtgatgatcaacaggacccagaaatggcacgagcccgggattggcctcccgggctcgccgcccccgaaccggcgcagcatgccgagtgaggacgtttgctctgtgacgagcgtacgagagaacagcgcgtcgacaccaccgcgccccgccggaccgaagtgccactgcggcaccccgatcgtccacatccccgggaagcgccccaaaatctactgctcggacgcctgccgaaagcgcgcaaagcgtctcattgcggaccagtcacgcagcgtagcaagcacgactacagcgggtaatccggacgcgggctttagtagtaagggaaaatctccgtccactgcaggtcagagcgctgtaactggaacgggttctaccccaaacgagggtgccgcgacagccgggcgggaggacccgcgcgacgagcggttcgcccggcgggaccggcaccagacggtgtcgctgaacgaggcgttcaagggctgcgggacccggctcactgccgggacggccgagctgatgtggaagccgggcgaggcgacgtggggcaacacgtgccgctgcaacaacgtccacacctgcccgtggtgcatgagccgcatcctggccgtacggggctcgaacgtgcagctcgccgccgacggtctcgcggacgccgggtacgggctgcaccttggcacgaacacgttgcgccacttcgagcgcatggcgttcggcaccgtccgcaagggaatgcggcacggcctggtcgcggtcttgcacgacggctggaagggcgcgtacggctcgtccggccgccgctggcgcacgatgcgcgacgacttcgggatcatcggctacgagcgggccttcgaggacaccttcggctggggctccggctggcacctgcactggcacacgctctgggtcacccgcgaggtgctcggcccggacgcccaggccgcgttccgcgacgcactcgccggagcctgggccgccggggtcgaatccgcgggcggctacaccgtcagcgagacgtgcgaccggcccggttgctcctgtgagggcaagggccacggcaccgacgtgcgcccactcaacggcgcggacgccgctgacggcgatgcgggcaagcaggcccgctacctctacaaggacggcgacaagaccaagggcggcgtcgccaagatcggcctggagctggccggacagaacttcaaggccggtcgcggcgacgaccgcatgggaccgctcgacctgggcgacgcggcggccgccgagctgcagcggcttcgtcggcccggcccgttcgtcgagaagtaccgcgagcgcgagttcggcgtcttccaggtccgcaagcactaccggtcgcagaacctgaaccggctgatcaaggaactcggcatccagcaggacgtccgcaccgaggaggagatcaccgacgacaccgagggcctggtcgccatcgcggtcatcccggcctacatctggtaccgatacatcgcccgcgtcgccggacgtcgcctcgacctcatcaaggtcgccgagacgtacggcctaccgggcgtccggcggctcgtcgagtcctggggcctggtgtggggcaaggacgtcctggacccgcccgccccggaagcgccggccgcgccgggcgaccttgacgctgaccagatgaggttcgaggtcatgtccgaggaggaagctgctttccgcgaggcgcgccggaaggccaacgaggcccgcacggaggagctggccgcttcgctcgaccgagtgcgtcagccgaagaaggaggcgatccgcccgacgatcagccttcggaagcgcctgaagccgaagccggtcaccgtcgacgtcaagactcccccgcccggcgccgcgtcgcccgtgtgccgccgctgcaagggcaagctcgccccggtactccagccctggggccggctccccggagactgcctccgcgtcgacacagcggtcgcgtagggccgctgagggaccgccatgagaccgccaccccggacatccgggtggcggtctcatggcggtcccggcgcgaaagccgagggtctgcctgccgtgaggtggccggcggacctgggttactgctggaatcccgcgcccagtccgagcgtccgccggcgcttttcacctggctccgggtgctcgtcgatgagcacca

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

PIJ12738

2019-08-03T09:11:08Z

HeeeenaJ: /* Characteristics */

{{DISPLAYTITLE: pIJ12738}}

=pIJ12738=

==Background==

==Construction==

==Uses==
Selecting for gene deletions in actinomycetes

==Characteristics==

Contains the meganuclease I-SceI recognition site

==Map and Sequence==

atctacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacctgatgcagctctcgcagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgttgatcggcactttgcatcggccgcgctcccgattccggaagtgcttgacattggggaatttatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgggctgcaggtcgactctagaggatccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatatcgagcttaccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagttagggataacagggtaatatcgaattcgtaatcatgtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggttcatgtgcagctccatcagcaaaaggggatgataagtttatcaccaccgactatttgcaacagtgccgttgatcgtgctatgatcgactgatgtcatcagcggtggagtgcaatgtcgtgcaatacgaatggcgaaaagccgagctcatcggtcagcttctcaaccttggggttacccccggcggtgtgctgctggtccacagctccttccgtagcgtccggcccctcgaagatgggccacttggactgatcgaggccctgcgtgctgcgctgggtccgggagggacgctcgtcatgccctcgtggtcaggtctggacgacgagccgttcgatcctgccacgtcgcccgttacaccggaccttggagttgtctctgacacattctggcgcctgccaaatgtaaagcgcagcgcccatccatttgcctttgcggcagcggggccacaggcagagcagatcatctctgatccattgcccctgccacctcactcgcctgcaagcccggtcgcccgtgtccatgaactcgatgggcaggtacttctcctcggcgtgggacacgatgccaacacgacgctgcatcttgccgagttgatggcaaaggttccctatggggtgccgagacactgcaccattcttcaggatggcaagttggtacgcgtcgattatctcgagaatgaccactgctgtgagcgctttgccttggcggacaggtggctcaaggagaagagccttcagaaggaaggtccagtcggtcatgcctttgctcggttgatccgctcccgcgacattgtggcgacagccctgggtcaactgggccgagatccgttgatcttcctgcatccgccagaggcgggatgcgaagaatgcgatgccgctcgccagtcgattggctgagctcatgagcggagaacgagatgacgttggaggggcaaggtcgcgctgattgctggggcaacacgtggagcggatcggggattgtctttcttcagctcgctgatgatatgctgacgctcaatgccgtttggcctccgactaacgaaaatcccgcatttggacggctgatccgattggcacggcggacggcgaatggcggagcagacgctcgtccgggggcaatgagatatgaaaaagcctgaactcaccgcgacgtatcgatgnnnntatgcaggtcgacggatcttttccgctgcataaccctgcttcggggtcattatagcgattttttcggtatatccatcctttttcgcacgatatacaggattttgccaaagggttcgtgtagactttccttggtgtatccaacggcgtcagccgggcaggataggtgaagtaggcccacccgcgagcgggtgttccttcttcactgtcccttattcgcacctggcggtgctcaacgggaatcctgctctgcgaggctggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgacttttttagccgctaaaacggccggggggtgcgcgtgattgccaagcacgtccccatgcgctccatcaagaagagcgacttcgcggagctggtgaagtacatcaccgacgagcaaggcaagaccgatccccggggacctgcatag

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

PIJ12742

2019-08-03T09:08:08Z

HeeeenaJ: /* Map and Sequence */

=pIJ12742=

==Background==

==Construction==

==Uses==
Selecting for gene deletions in actinomycetes

==Characteristics==

==Map and Sequence==

ggccgtcgacgacgacgcgtccgcctgcctgcttttggccggcgggccgggccgcggttgtccgccgggtcggaccggtcccttggtcgaccgatgcctcggccacgacgatgctgggcccgaagcggtacgcgaacccgtgccgggctgcggcggatcgcggcagcaggagctccccgcccgccacggctggctggatggtcgcctcacgcgcccgcaggggtgacggcgtgggtgcggcggtcagccccgtgatcgggcgtcagacggccgctgagggaccgcgaccacccctcccttcccgcctgccgtctttcaccgcccggccggtccgcagacgccgtacggccaggccacggaggattacgggcagatggcgcccacccggcacccgggctggggcaccctggacagcacgaaggcccgccccactcaccggggcgggccttcgcgttgagctagagttcccgccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaatgcagctcacggtaactgatgccgtatttgcagtaccagcgtacggcccacagaatgatgtcacgctgaaaatgccggcctttgaatgggttcatgtgcagctccatcagcaaaaggggatgataagtttatcaccaccgactatttgcaacagtgccgttgatcgtgctatgatcgactgatgtcatcagcggtggagtgcaatgtcgtgcaatacgaatggcgaaaagccgagctcatcggtcagcttctcaaccttggggttacccccggcggtgtgctgctggtccacagctccttccgtagcgtccggcccctcgaagatgggccacttggactgatcgaggccctgcgtgctgcgctgggtccgggagggacgctcgtcatgccctcgtggtcaggtctggacgacgagccgttcgatcctgccacgtcgcccgttacaccggaccttggagttgtctctgacacattctggcgcctgccaaatgtaaagcgcagcgcccatccatttgcctttgcggcagcggggccacaggcagagcagatcatctctgatccattgcccctgccacctcactcgcctgcaagcccggtcgcccgtgtccatgaactcgatgggcaggtacttctcctcggcgtgggacacgatgccaacacgacgctgcatcttgccgagttgatggcaaaggttccctatggggtgccgagacactgcaccattcttcaggatggcaagttggtacgcgtcgattatctcgagaatgaccactgctgtgagcgctttgccttggcggacaggtggctcaaggagaagagccttcagaaggaaggtccagtcggtcatgcctttgctcggttgatccgctcccgcgacattgtggcgacagccctgggtcaactgggccgagatccgttgatcttcctgcatccgccagaggcgggatgcgaagaatgcgatgccgctcgccagtcgattggctgagctcataagttcctattccgaagttcctattcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccccaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgaattgtacgtaggatccagcccgacccgagcacgcgccggcacgcctggtcgatgtcggaccggagttcgaggtacgcggcttgcaggtccaggaaggggacgtccatgcgagtgtccgttcgagtggcggcttgcgcccgatgctagtcgcggttgatcggcgatcgcaggtgcacgcggtcgatcttgacggctggcgagaggtgcggggaggatctgaccgacgcggtccacacgtggcaccgcgatgctgttgtgggcacaatcgtgccggttggtaggatcgtctagaacaggaggccccatatgcaccagaagaaccaggtcatgaacctgggcccgaactccaagctgctgaaggagtacaagtcccagctgatcgagctgaacatcgagcagttcgaggccggcatcggcctgatcctgggcgacgcctacatccgctcccgcgacgagggcaagacctactgcatgcagttcgagtggaagaacaaggcctacatggaccacgtctgcctgctgtacgaccagtgggtcctgtccccgccgcacaagaagcagcgcgtcaaccacctgggcaacctggtcatcacctggggcgcccagaccttcaagcaccaggccttcaacaagctggccaacctgttcatcgtcaacaacaagaagaccatcccgaacaacctggtcgagaactacctgaccccgatgtccctggcctactggttcatggacgacggcggcaagtgggactacaacaagaactccaccaacaagtccatcgtcctgaacacccagtccttcaccttcgaggaggtcgagtacctggtcaagggcctgcgcaacaagttccagctgaactgctacgtcaagatcaacaagaacaagccgatcatctacatcgactccatgtcctacctgatcttctacaacctgatcaagccgtacctgatcccgcagatgatgtacaagctgccgaacaccatctcctccgagaccttcctgaagtgataaaccgatacaattaaaggctccttttggagcctttttttttggagattttcaacgtgaaaaaattattattcgcaattccaacaaaaggctggagctccaccgcggccgcgcgcgatatcgaattccccagatctaaagttttgtcgtctttccagacgttagtaaatgaattttctgtatgaggttttgctaaacaactttcaacagtttcagcggagtgagaatagaaaggaacaactaaaggaattgcgaataataattttttcacgttgaaaatctccaaaaaaaaaggctccaaaaggagcctttaattgtatcggtttatcagcttgctttcgaggtgaatttcttaaacagcttgataccgatagttgcgccgacaatgacaacaaccatcgcccacgcataaccgatatattcggtcgctgaggcttgcagggagtcaaaggccgcttttgcgggatctcgtcgaaggcactagaaggcctatatgcggggatcgaccgcgcgggtcccggacggggaagagcggggagctttgccagagagcgacgacttccccttgcgttggtgattgccggtcagggcagccatccgccatcgtcgcgtagggtgtcacaccccaggaatcgcgtcactgaacacagcagccggtaggacgaccatgactgagttggacaccatcgcaaatccgtccgatcccgcggtgcagcggatcatcgatgtcaccaagccgtcgcgatccaacataaagacaacgttgatcgaggacgtcgagcccctcatgcacagcatcgcggccggggtggagttcatcgaggtctacggcagcgacagcagtccttttccatctgagttgctggatctgtgcgggcggcagaacataccggtccgcctcatcgactcctcgatcgtcaaccagttgttcaagggggagcggaaggccaagacattcggcatcgcccgcgtccctcgcccggccaggttcggcgatatcgcgagccggcgtggggacgtcgtcgttctcgacggggtgaagatcgtcgggaacatcggcgcgatagtacgcacgtcgctcgcgctcggagcgtcggggatcatcctggtcgacagtgacatcaccagcatcgcggaccggcgtctccaaagggccagccgaggttacgtcttctcccttcccgtcgttctctccggtcgcgaggaggccatcgccttcattcgggacagcggtatgcagctgatgacgctcaaggcggatggcgacatttccgtgaaggaactcggggacaatccggatcggctggccttgctgttcggcagcgaaaagggtgggccttccgacctgttcgaggaggcgtcttccgcctcggtttccatccccatgatgagccagaccgagtctctcaacgtttccgtttccctcggaatcgcgctgcacgagaggatcgacaggaatctcgcggccaaccgataagcgcctctgttcctcggacgctcggttcctcgacctcgattcgtcagtgatgatcaacaggacccagaaatggcacgagcccgggattggcctcccgggctcgccgcccccgaaccggcgcagcatgccgagtgaggacgtttgctctgtgacgagcgtacgagagaacagcgcgtcgacaccaccgcgccccgccggaccgaagtgccactgcggcaccccgatcgtccacatccccgggaagcgccccaaaatctactgctcggacgcctgccgaaagcgcgcaaagcgtctcattgcggaccagtcacgcagcgtagcaagcacgactacagcgggtaatccggacgcgggctttagtagtaagggaaaatctccgtccactgcaggtcagagcgctgtaactggaacgggttctaccccaaacgagggtgccgcgacagccgggcgggaggacccgcgcgacgagcggttcgcccggcgggaccggcaccagacggtgtcgctgaacgaggcgttcaagggctgcgggacccggctcactgccgggacggccgagctgatgtggaagccgggcgaggcgacgtggggcaacacgtgccgctgcaacaacgtccacacctgcccgtggtgcatgagccgcatcctggccgtacggggctcgaacgtgcagctcgccgccgacggtctcgcggacgccgggtacgggctgcaccttggcacgaacacgttgcgccacttcgagcgcatggcgttcggcaccgtccgcaagggaatgcggcacggcctggtcgcggtcttgcacgacggctggaagggcgcgtacggctcgtccggccgccgctggcgcacgatgcgcgacgacttcgggatcatcggctacgagcgggccttcgaggacaccttcggctggggctccggctggcacctgcactggcacacgctctgggtcacccgcgaggtgctcggcccggacgcccaggccgcgttccgcgacgcactcgccggagcctgggccgccggggtcgaatccgcgggcggctacaccgtcagcgagacgtgcgaccggcccggttgctcctgtgagggcaagggccacggcaccgacgtgcgcccactcaacggcgcggacgccgctgacggcgatgcgggcaagcaggcccgctacctctacaaggacggcgacaagaccaagggcggcgtcgccaagatcggcctggagctggccggacagaacttcaaggccggtcgcggcgacgaccgcatgggaccgctcgacctgggcgacgcggcggccgccgagctgcagcggcttcgtcggcccggcccgttcgtcgagaagtaccgcgagcgcgagttcggcgtcttccaggtccgcaagcactaccggtcgcagaacctgaaccggctgatcaaggaactcggcatccagcaggacgtccgcaccgaggaggagatcaccgacgacaccgagggcctggtcgccatcgcggtcatcccggcctacatctggtaccgatacatcgcccgcgtcgccggacgtcgcctcgacctcatcaaggtcgccgagacgtacggcctaccgggcgtccggcggctcgtcgagtcctggggcctggtgtggggcaaggacgtcctggacccgcccgccccggaagcgccggccgcgccgggcgaccttgacgctgaccagatgaggttcgaggtcatgtccgaggaggaagctgctttccgcgaggcgcgccggaaggccaacgaggcccgcacggaggagctggccgcttcgctcgaccgagtgcgtcagccgaagaaggaggcgatccgcccgacgatcagccttcggaagcgcctgaagccgaagccggtcaccgtcgacgtcaagactcccccgcccggcgccgcgtcgcccgtgtgccgccgctgcaagggcaagctcgccccggtactccagccctggggccggctccccggagactgcctccgcgtcgacacagcggtcgcgtagggccgctgagggaccgccatgagaccgccaccccggacatccgggtggcggtctcatggcggtcccggcgcgaaagccgagggtctgcctgccgtgaggtggccggcggacctgggttactgctggaatcccgcgcccagtccgagcgtccgccggcgcttttcacctggctccgggtgctcgtcgatgagcacca

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

PIJ12738

2019-08-03T09:07:26Z

HeeeenaJ: /* Map and Sequence */

{{DISPLAYTITLE: pIJ12738}}

=pIJ12738=

==Background==

==Construction==

==Uses==
Selecting for gene deletions in actinomycetes

==Characteristics==

==Map and Sequence==

atctacgtctgtcgagaagtttctgatcgaaaagttcgacagcgtctccgacctgatgcagctctcgcagggcgaagaatctcgtgctttcagcttcgatgtaggagggcgtggatatgtcctgcgggtaaatagctgcgccgatggtttctacaaagatcgttatgttgatcggcactttgcatcggccgcgctcccgattccggaagtgcttgacattggggaatttatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgggctgcaggtcgactctagaggatccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatatcgagcttaccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagttagggataacagggtaatatcgaattcgtaatcatgtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttggttcatgtgcagctccatcagcaaaaggggatgataagtttatcaccaccgactatttgcaacagtgccgttgatcgtgctatgatcgactgatgtcatcagcggtggagtgcaatgtcgtgcaatacgaatggcgaaaagccgagctcatcggtcagcttctcaaccttggggttacccccggcggtgtgctgctggtccacagctccttccgtagcgtccggcccctcgaagatgggccacttggactgatcgaggccctgcgtgctgcgctgggtccgggagggacgctcgtcatgccctcgtggtcaggtctggacgacgagccgttcgatcctgccacgtcgcccgttacaccggaccttggagttgtctctgacacattctggcgcctgccaaatgtaaagcgcagcgcccatccatttgcctttgcggcagcggggccacaggcagagcagatcatctctgatccattgcccctgccacctcactcgcctgcaagcccggtcgcccgtgtccatgaactcgatgggcaggtacttctcctcggcgtgggacacgatgccaacacgacgctgcatcttgccgagttgatggcaaaggttccctatggggtgccgagacactgcaccattcttcaggatggcaagttggtacgcgtcgattatctcgagaatgaccactgctgtgagcgctttgccttggcggacaggtggctcaaggagaagagccttcagaaggaaggtccagtcggtcatgcctttgctcggttgatccgctcccgcgacattgtggcgacagccctgggtcaactgggccgagatccgttgatcttcctgcatccgccagaggcgggatgcgaagaatgcgatgccgctcgccagtcgattggctgagctcatgagcggagaacgagatgacgttggaggggcaaggtcgcgctgattgctggggcaacacgtggagcggatcggggattgtctttcttcagctcgctgatgatatgctgacgctcaatgccgtttggcctccgactaacgaaaatcccgcatttggacggctgatccgattggcacggcggacggcgaatggcggagcagacgctcgtccgggggcaatgagatatgaaaaagcctgaactcaccgcgacgtatcgatgnnnntatgcaggtcgacggatcttttccgctgcataaccctgcttcggggtcattatagcgattttttcggtatatccatcctttttcgcacgatatacaggattttgccaaagggttcgtgtagactttccttggtgtatccaacggcgtcagccgggcaggataggtgaagtaggcccacccgcgagcgggtgttccttcttcactgtcccttattcgcacctggcggtgctcaacgggaatcctgctctgcgaggctggccggcatgagcctgtcggcctacctgctggccgtcggccagggctacaaaatcacgggcgtcgtggactatgagcacgtccgcgagctggcccgcatcaatggcgacctgggccgcctgggcggcctgctgaaactctggctcaccgacgacccgcgcacggcgcggttcggtgatgccacgatcctcgccctgctggcgaagatcgaagagaagcaggacgagcttggcaaggtcatgatgggcgtggtccgcccgagggcagagccatgacttttttagccgctaaaacggccggggggtgcgcgtgattgccaagcacgtccccatgcgctccatcaagaagagcgacttcgcggagctggtgaagtacatcaccgacgagcaaggcaagaccgatccccggggacctgcatag

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

PIJ12742

2019-08-03T09:06:03Z

HeeeenaJ:

=pIJ12742=

==Background==

==Construction==

==Uses==
Selecting for gene deletions in actinomycetes

==Characteristics==

==Map and Sequence==

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

PIJ12742

2019-08-02T20:14:36Z

HeeeenaJ: Background

==Background==

PIJ12738

2019-08-02T20:14:00Z

HeeeenaJ: /* Uses */

{{DISPLAYTITLE: pIJ12738}}

=pIJ12738=

==Background==

==Construction==

==Uses==
Selecting for gene deletions in actinomycetes

==Characteristics==

==Map and Sequence==

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

PIJ12738

2019-08-02T20:05:46Z

HeeeenaJ: /* References */

{{DISPLAYTITLE: pIJ12738}}

=pIJ12738=

==Background==

==Construction==

==Uses==

==Characteristics==

==Map and Sequence==

==References==
Fernández-Martínez LT, Bibb MJ. Use of the meganuclease I-SceI of Saccharomyces cerevisiae to select for gene deletions in actinomycetes. Sci Rep. 2014;4:7100. Published 2014 Nov 18. doi:10.1038/srep07100

Plasmids

2019-07-30T14:11:04Z

HeeeenaJ: /* Plasmids used in Streptomyces */

[[File:Actinobase-icons-trans_Plasmids.png|150px|Plasmids|link=Plasmids]]

Various plasmids have been developed for use in Streptomyces (most will also contain an origin of replication that functions in Escherichia coli, for cloning, general maintenance, and [[intergenic conjugation into Streptomyces]]). Many of the plasmids commonly used for Streptomyces work are '''integrative''': they insert into a specific site on the Streptomyces chromosome using a [[site-specific phage recombinase]].

The following is an alphabetical list of a number of useful vectors - see also [[Table of Streptomyces vectors]].

==Plasmids used in Streptomyces==

[[pCAP03]]

[[pCRISPomyces2]]

[[pESAC13]]

[[pIJ101]]

[[pIJ8660]]

[[pIJ10257]]

[[pIJ12738]]

[[pIJ12742]]

[[pKC1132]]

[[pMF96]]

[[pMS82]]

[[pRT802]]

[[pSET152]]

[[pSS170]]

[[Supercos1]]

==Plasmids used for PCR targeting (Redirect)==

[[pIJ773]]

==Plasmids used for heterologous protein expression in E. coli==

The following plasmids are frequently used to express proteins heterologously in E. coli, e.g. for two-hybrid analysis or protein purification.

[[pET28a]]

[[pKNT25]] | [[pKT25]] | [[pUT18]] | [[pUT18C]]