ActinoBase - User contributions [en-gb]

CRISPR/Cas9-mediated genome editing

2023-11-16T10:02:10Z

J Newitt: /* Golden gate assembly of annealed gRNA into pCRISPomyces-2 */

=CRISPR/Cas9 Genome editing=
CRISPR/Cas9 genome editing can be used for precise CRISPR/Cas9-mediated genome engineering of Streptomyces strains. Mutations made have ranged from 1-100kbp deletions, precise codon changes to alter amino acids and insertions to add Flag-tags to proteins encoded at their native loci. Several different plasmids have been constructed and published and are listed below. Click the links to find out more.

[https://pubs.acs.org/doi/10.1021/acssynbio.5b00038 pCRISPR-Cas9]

[[pCRISPomyces2]]

For a comprahensive guide for CRISPR/Cas knockouts in ''Streptomyces'' using pCRISPomyces-2 see the link below to the 'Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2', written by Dr. Rebecca Devine.

[https://actinobase.org/downloads/pCRISPomyces2.pdf Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2]

==Organisms==
This protocol has been confrimed to work for the following-

*[[Streptomyces coelicolor]]
*[[Streptomyces formicae]]
*[[Streptomyces venezuelae]]

==Workflow Overview==

1. Design flanking primers and gRNA

2. Optimise primer conditions using gradient PCR on flanking primers using WT genomic DNA (gDNA)

3. Anneal guide RNA oligos (gRNA) oligos using oligo spacer programme

4. Golden gate assembly of annealed gRNA into plasmid

5. Transform vector into ''E. coli'' using heat shock

6. Select for successful transformants using blue/white screening to select successful insertion of the gRNA into the vector

7. Recover plasmid by miniprep

8. Amplify up flanks using gDNA and optimised primer conditions

9. Gel extract flanks

10. Linearize [[pCRISPomyces-2]] vector + gRNA generated above using XbaI digestion

11. Gel purify vector

12. Gibson Assembly of flanks into digested vector

13. Transform into chemically competent ''E. coli'' NEB DH5alpha cells

14. Grow cells on [[LB]] + Apr plates to select for transformants

15. Confirm transformation using colony PCR (or XbaI digestion of plasmid prep)

16. Extract plasmid DNA from successful colony(s) by plasmid prep

17. Transform finished construct into ET cells using electroporation

18. Conjugate ET into Streptomyces and antibiotic treat to select for ex-conjugants

==Designing flanking primers==

1. Find the sequence for your target gene

2. Keep the start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), and delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC)

3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC

4. Design ~20NT external flanking primers with 60-70% GC and ~68°C Tm

5. Insert XbaI and gibson overlap sequence on end (not essential but increases efficiency of Gibson assembly and allows templates to be digested out/cloned back in)

==Designing gRNA==

1. Open a new (unedited) copy of the target gene sequence

2. Look at the REVERSE STRAND

3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes)

4. Design ~20 NT gRNA with a Tm > 60°C

5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against the full genome to check gRNA specificity. It is more important to not have matching sequences on the 3’ end

6. Add BbsI cut site sticky ends for golden gate assembly

The website [https://crispy.secondarymetabolites.org/#/input CRISPY-web] can also be used to gRNA design, simply upload your target genome and define a target region. The software will then provide a list the most unique PAM sequences & gRNAs it can find within the target region.

==Anneal gRNA using oligo spacer programme==

1. Mix 5 μl 100μM Forward gRNA and 5 μl 100μM Reverse gRNA oligo with 90 μl HEPES buffer

2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme

==Golden gate assembly of annealed gRNA into [[pCRISPomyces-2]]==

Set up 20 μl reactions with:

• 100 ng backbone

• 0.3 μl gRNA

• 2 μl T4 ligase buffer (NEB)

• 1 μl T4 ligase (NEB)

• 1 μl BbsI (NEB)

• dH2O

Incubate using golden gate programme (as below)

1. 10 minutes at 37°C

2. 10 minutes at 16°C

3. Go to step 1, 9 times

4. 1 cycle of 5 minutes at 50°C

5. 1 cycle of 20 minutes at 65°C

6. 4°C hold

==Transform Golden Gate plasmid into ''E. coli'' using heat shock==

1. Thaw chemically competent NEB5/Top10 cells on ice

2. Transfer 50 μl of competent cells to a 1.5 ml microcentrifuge tube

3. Add 2 μl assembled vector and mix gently (tip mix, DO NOT VORTEX!!)

4. Incubate on ice for 30 minutes (DO NOT MIX!!)

5. Heat shock cells at 42°C for 30 seconds

6. Transfer tubes on ice for 2 minutes

7. Add 950 μl SOC media and incubate at 37°C for 1 hour at 250 rpm to allow recovery

8. Plate onto pre-warmed [[LB]] + Apramycin + X-gal plates and incubate at 37°C overnight

==Select for successful transformants using blue/white selection==

Golden gate cloning into [[pCRISPomyces-2]] uses blue white screening to select for successful transformants (See AddGene blog [https://blog.addgene.org/plasmids-101-blue-white-screening here] for an explaination of blue-white screening). Pick white colonies and grow overnight in 10 ml [[LB]] + Apramycin then extract plasmid DNA from successful colony(s).

2. Grow up successful (white) colonies in [[LB]] at 37°C overnight

3. Recover plasmid using the QIAprep Spin Miniprep kit (Qiagen) (or a plasmid miniprep kit of choice)

4. Pellet ~3 ml cells by centrifugation

5. Resuspend cells in 250 μl Buffer P1 and 250 μl Buffer P2

6. After 2-3 minutes of lysis reaction add Buffer N3 and centrifuge samples at 13000 rpm for 10 minutes

7. Apply supernatant to a BLUE QIAprep spin column and centrifuge for 30 seconds

8. Wash the column with 750 µl Buffer PE

9. Discard the flow through and elute plasmid DNA in 50 μl dH2O

10. Quantify using Nanodrop and take note of concentration for use in the next steps

==Linearize gRNA vector using XbaI digestion==

1. Incubate or 1 μg vector with 1 μl XbaI, 5 μl buffer H and 40 μl dH2O at 37°C for approximately 2 hours

2. Dephosphorylate with shrimp alkaline phosphatase

3. Run product on a gel against undigested vector and visualise using UV

4. Excise band using a scalpel and extract DNA using the QIAquick gel extraction kit

==Gibson Assembly of flanks into digested vector==

1. PCR Amplify flanking DNA using Q5 (high fidelity – less errors, good for cloning) (Note: See [[High GC PCR]] for tips on how to perform PCR amplifications off of high GC genomes such as ''Streptomyces''.)

2. Gel purify using Qiagen kit

3. Incubate digested vector with 2x flanks (aim for roughly 3:1 vector:insert) and 10 μl Gibson Assembly master mix (NEB) at 50°C for at least 15 minutes (longer gives better efficiency – I usually leave it for 1 hour)

4. Transform into chemically competent ''E. coli'' using heat shock (see above)

==Confirm transformation using colony PCR==

Conduct under STERILE conditions!!

1. Take ~8 1.5 ml microcentrifuge tubes (less if fewer colonies) and fill with ~500 µl [[LB]]

2. Make up Biotaq Red master mix with 1% v/v primer

3. Using a p10 tip, pick colony and touch tip to empty PCR tube before discarding into [[LB]] tube

4. Add 10 μl master mix to each PCR tube and amplify (55°C for pCRISP-2 test primers)

5. Run products on gel to see insert

6. Innoculate successful colonies in 10 ml [[LB]] (using the 500 µl [[LB]] plus tip)

7. Recover plasmid by same method as previously

==Transform finished plasmid into ET cells using electroporation==
1. Streptomyces strains contain a methyl-sensing restriction system therefore disrupted cosmids must initially be passaged through a non-methylating ''E. coli'' strain

2. Thaw ET cells on ice

3. Cool cuvette on ice

4. Electropotate using appropriate settings using 1 μl cosmid DNA in 50 μl of electrocompetent ET12567 cells containing the driver plasmid [[pUZ8002]] and “pulse”

5. Take care not to hold the metal parts of the cuvette to warm it up

6. Reading should be around 5.4

7. Add 900 μl [[LB]] and pipette tip mix

8. Transfer to eppendorf & grow at 37ºC up for 1 hour to recover

11. Plate onto [[LB]] agar containing kanamycin, apramycin and chloramphenicol to select for the incoming plasmid

12. Incubate plates at 37ºC overnight

13. Pick colonies, grow overnight in liquid culture and use for conjugation and glycerol stock

==Conjugate ET into ''Streptomyces'' treat with antibiotics to select for ex-conjugants==
Also see [[Conjugation using ET12567/pUZ8002]]

1. Grow ''E. coli'' colonies selected from transformation plates in 10 ml [[LB]] broth plus Kanamycin, Chloramphenicol and Apramycin at 37°C overnight rotating at 250 rpm

2. Sub-culture ''E. coli'' under the same conditions for approximately 4 hours the following day

3. Once sub-cultures have reached OD600 0.6-0.8, wash the cells twice in [[LB]] to remove antibiotics that might inhibit the Streptomyces by spinning at 4000 rpm for 5 minutes.

4. Pre-germinate Streptomyces spores in [[2X YT]] at 50°C for 10 minutes, leave to cool

5. Combine cells, centrifuge and resuspended in 200 μl [[LB]]

6. Plate dilutions of approx. 200 μl onto [[SFM]] agar + MgCl2 and incubated at 30°C for 16-20 hours (I increase the time for CRISPR conjugations compared to other vectors e.g. integrative plasmids i.e. use 20 hours rather than 16)

7. Overlay with 1 ml of dH2O + 0.5 mg Nalidixic acid + 1.25 mg Apramycin to selectively kill the ''E. coli''

8. Return plates to the incubator at 30°C for four days or until colonies appeared (Often takes longer for CRISPR ex-conjugants to appear compared to other vectors e.g. integrative plasmids i.e. if normally takes 3-4 days expect to leave plates for 5-6 days AT LEAST!)

Protocol developed & written by Dr. Rebecca Devine, University of East Anglia, adapted for ActinoBase from [https://actinobase.org/downloads/pCRISPomyces2.pdf Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2].

Salting Out Genomic DNA Extraction Method

2020-08-18T12:49:04Z

J Newitt:

=Isolation of high molecular weight (HMW) genomic DNA by salting out=

The salting out method is used to isolate high yields of high molecular weight DNA, usually for applications such as whole genome sequencing. It is particularly useful for long read sequencing such as PacBIO and Nanopore, as ''Streptomyces'' has long regions of repetitive DNA sequences.

It is recommended that a whole day is allocated for this protocol, particularly if it is the first time conducting it.

==Preparation and reagents needed==
*Mycelium from 25ml culture (split a 50ml culture into 2)
*SET buffer:- 75mM NaCl, 25mM EDTA pH8, 20mM Tris-HCl pH7.5
*Lysozyme:- 50mg ml-1
*Proteinase K:- 20mg ml-1
*SDS:- 10%
*NaCl:- 5M
*Isopropanol
*70% Ethanol
*TE buffer of sterilised dH2O
*Sealed Pateur pipette
*Eppendorf tubes
*10ml pipettes
*Yellow tips/blue tips and P200/P1000 pipette
*5ml or 10ml pipette

'''Instructions'''
#Resuspend mycelium in 5ml SET buffer in a 50ml falcon tube. Add 100µl of lysozyme solution. Incubate at 37 degrees C° for 1-3 hours, lysis step is complete when the reaction has clarified and turned viscous. Note that the reaction may not clarify completely, this stage may require organism specific optimisation.
#Add 140µl proteinase K solution and 600µl 10% SDS, then mix by inversion. Incubate at 55° for 2 hours and invert occasionally
#Add 2ml 5M NaCl and mix by inversion
#Allow to temperature to cool to 37° or lower before adding 5ml chloroform. Mix by inversion for 30 minutes at 20°
#Centrifuge at 4500g for 15 minutes at 20°
#Carefully remove the top layer with a cut pipette tip and transfer to a clean tube. If the solution is still opaque, consider adding more NaCl, SDS and Chloroform as per steps 2-4 and repeat step 5
#The solution should be incubated on ice for 2 minutes, before adding 0.6 vol ice cold isopropanol. Mix by inversion and continue to incubate on ice for around 3 minutes. Spool DNA onto a sealed pasteur pipette
#Rinse DNA in 5ml 70% ethanol and leave to air dry. Using cut tips, resuspend in 500µl of TE or sterilised dH2O

==Uses==
*[[Whole Genome Sequencing]]
*[[Template Generation for PCR]]

==Notes==
For growth in liquid culture, [[DNA]] can be made without the agar ([[DNB]]).

==References==

Adapted from Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F. and Hopwood, D.A., 2000. Practical ''Streptomyces'' genetics (Vol. 291). Norwich: John Innes Foundation.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Trace element solution

2020-08-14T15:22:51Z

J Newitt:

'''Trace element solution (per liter):'''
*40 mg ZnCl2
*200 mg FeCl3 . 6H2O
*10 mg CuCl2 . 2H2O
*10 mg MnCl2 . 4H2O
*10 mg Na2B4O7 . 10H2O
*10 mg (NH4)6Mo7O24 . 4H2O

'''Uses'''
*[[R2]]
*[[R5]]
*[[MYM]]
*[[MM]]

Trace element solution

2020-08-14T15:21:02Z

J Newitt:

Links

2019-10-10T16:03:28Z

J Newitt: /* DNA sequence analysis */

=Useful Links=

==Bioinformatics==

===16S rRNA metaprofiling===

[https://greengenes.secondgenome.com Green Genes] 16S rRNA gene database

[https://www.arb-silva.de/ SILVA] 16S, 18S, SSU & LSU rRNA gene database

[http://qiime.org QIIME™] or [https://www.mothur.org Mothur] for analyzing 16S rRNA gene sequences.

===Genome-based taxonomic analysis===

[https://tygs.dsmz.de/ TYGS] Type (Strain) Genome Server

===DNA sequence analysis===

[https://www.ebi.ac.uk/Tools/msa/clustalo/ Clustal Omega sequence alignment]

[https://web.expasy.org/translate/ Expasy translate tool]

[http://meme-suite.org MEME: for identification of DNA binding sites in ChIP-seq data ]

[http://nc2.neb.com/NEBcutter2/ NEB Restriction enzyme cutter]

[http://streptomyces.org.uk/actinoblast/ Tables of Streptomyces coelicolor reciprocal BLASTP hits]

[https://rfam.xfam.org// RNA family database]

===Genome mining tools===

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

[https://antismash.secondarymetabolites.org/#!/start antiSMASH]:1 (antibiotics and Secondary Metabolite Analysis Shell)
*Identification and annotation of secondary metabolite gene clusters
*[https://twitter.com/antiSMASH_dev Twitter]

[http://grid.adapsyn.com/prism/#!/prism PRISM]:2 (PRediction Informatics for Secondary Metabolism)
*Identification of nonribosomal peptides, type I and II polyketides and RiPPs

[http://bagel4.molgenrug.nl/ BAGEL]:3
* Identification of gene clusters for bacteriocins and RiPPs

[https://omictools.com/clusean-tool CLUSEAN]:4
*Annotation and analysis of secondary metabolite gene clusters

[https://github.com/petercim/ClusterFinder ClusterFinder]:5
*Identification of secondary metabolite gene clusters

[https://arts3.ziemertlab.com/ ARTS]:6 (Antibiotic Resistant Target Seeker)
*Genome mining for secondary metabolites and potential antibiotics based on antibiotic resistance targets

[https://sourceforge.net/projects/secmetdb/ 2metDB]:7
*Genome mining for polyketides and nonribosomal peptides

[http://pks.kaist.ac.kr/pkminer/ PKMiner]:8
*Genome mining for type II polyketide synthases

[http://www.nii.ac.in/sbspks2.html SBSPKS]:9
*Sequence analysis of polyketide synthases

[http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php RiPPMINER]:10
*Genome mining and deciphering chemical structures of RiPPs

[http://www.ripprodeo.org/manual.html RODEO]:11 (Rapid ORF Description and Evaluation Online)
*Identification of biosynthetic gene clusters and prediction of RiPP precursor peptides

[https://github.com/streptomyces/ripper RiPPER]:12
*Identification of RiPP precursor peptides and biosynthetic gene clusters

[https://omictools.com/big-scape-tool BiG-SCAPE]

[https://github.com/nselem/EvoMining/wiki EvoMining]

====References====

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

===Protein & peptide analysis===

Useful resources for analysing protein and peptide features, structures and families:

STRING: https://string-db.org/
*Protein-Protein Interaction Networks

pFam: https://pfam.xfam.org/
*Database of protein families

Phobius: http://phobius.cbr.su.se/
*Combined transmembrane topology and signal peptide predictor

SignalP: http://www.cbs.dtu.dk/services/SignalP/
*Signal peptide predictor

PDB: https://www.rcsb.org/
*Protein data bank

Phyre2: http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index
*Protein fold recognition

ExPASy: https://expasy.org/proteomics
*Collection of proteomics resources

MEME suite: http://meme-suite.org/tools/meme
*Motif-based sequence analysis

===Sequence databases===

[https://www.embl.de EMBL]

[https://www.ncbi.nlm.nih.gov NCBI]

[https://img.jgi.doe.gov/ IMG/M]

[https://genome.jgi.doe.gov/portal/ JGI Genome Portal]

==Genomes==

[[File:Actinobase-icons-trans_Background.png|150px|Genomes|link=Genomes]]

[http://strepdb.streptomyces.org.uk/cgi-bin/dc3.pl?accession=AL645882&start=4291472&end=4302043&iorm=map&width=900 StrepDB]: the Streptomyces genome database curated by the [http://www.jic.ac.uk John Innes Centre], Norwich, UK.

[http://avermitilis.ls.kitasato-u.ac.jp Streptomyces avermitilis genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-coelicolor.html Streptomyces coelicolor genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-scabies.html Streptomyces scabies genome project]

==Suppliers==

[https://www.biost.com BioS&T]: custom made genome libraries including bacterial two hybrid and ePAC clone libraries for capturing complete biosynthetic gene clusters.

[http://www.mrdnalab.com Mr DNA]: for fast, cheap and reliable 16S, 18S & ITS rDNA amplicon sequencing for community profiling.

[https://www.vertis-biotech.com/Home Vertis Biotech]: cappable RNA-sequencing for mapping transcript start sites and all other RNA-seq techniques.

[https://www.dsmz.de DSMZ]: supplier of a broad variety of actinomycetes.

==[http://streptomyces.org.uk Additional Streptomyces resources including the StrepDB genome database]==

Links

2019-10-10T15:58:51Z

J Newitt: /* DNA sequence analysis */

=Useful Links=

==Bioinformatics==

===16S rRNA metaprofiling===

[https://greengenes.secondgenome.com Green Genes] 16S rRNA gene database

[https://www.arb-silva.de/ SILVA] 16S, 18S, SSU & LSU rRNA gene database

[http://qiime.org QIIME™] or [https://www.mothur.org Mothur] for analyzing 16S rRNA gene sequences.

===Genome-based taxonomic analysis===

[https://tygs.dsmz.de/ TYGS] Type (Strain) Genome Server

===DNA sequence analysis===

[https://www.ebi.ac.uk/Tools/msa/clustalo/ Clustal Omega sequence alignment]

[https://web.expasy.org/translate/ Expasy translate tool]

[http://meme-suite.org MEME: for identification of DNA binding sites in ChIP-seq data ]

[http://nc2.neb.com/NEBcutter2/ NEB Restriction enzyme cutter]

[http://streptomyces.org.uk/actinoblast/ Tables of Streptomyces coelicolor reciprocal BLASTP hits]

===Genome mining tools===

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

[https://antismash.secondarymetabolites.org/#!/start antiSMASH]:1 (antibiotics and Secondary Metabolite Analysis Shell)
*Identification and annotation of secondary metabolite gene clusters
*[https://twitter.com/antiSMASH_dev Twitter]

[http://grid.adapsyn.com/prism/#!/prism PRISM]:2 (PRediction Informatics for Secondary Metabolism)
*Identification of nonribosomal peptides, type I and II polyketides and RiPPs

[http://bagel4.molgenrug.nl/ BAGEL]:3
* Identification of gene clusters for bacteriocins and RiPPs

[https://omictools.com/clusean-tool CLUSEAN]:4
*Annotation and analysis of secondary metabolite gene clusters

[https://github.com/petercim/ClusterFinder ClusterFinder]:5
*Identification of secondary metabolite gene clusters

[https://arts3.ziemertlab.com/ ARTS]:6 (Antibiotic Resistant Target Seeker)
*Genome mining for secondary metabolites and potential antibiotics based on antibiotic resistance targets

[https://sourceforge.net/projects/secmetdb/ 2metDB]:7
*Genome mining for polyketides and nonribosomal peptides

[http://pks.kaist.ac.kr/pkminer/ PKMiner]:8
*Genome mining for type II polyketide synthases

[http://www.nii.ac.in/sbspks2.html SBSPKS]:9
*Sequence analysis of polyketide synthases

[http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php RiPPMINER]:10
*Genome mining and deciphering chemical structures of RiPPs

[http://www.ripprodeo.org/manual.html RODEO]:11 (Rapid ORF Description and Evaluation Online)
*Identification of biosynthetic gene clusters and prediction of RiPP precursor peptides

[https://github.com/streptomyces/ripper RiPPER]:12
*Identification of RiPP precursor peptides and biosynthetic gene clusters

[https://omictools.com/big-scape-tool BiG-SCAPE]

[https://github.com/nselem/EvoMining/wiki EvoMining]

====References====

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

===Protein & peptide analysis===

Useful resources for analysing protein and peptide features, structures and families:

STRING: https://string-db.org/
*Protein-Protein Interaction Networks

pFam: https://pfam.xfam.org/
*Database of protein families

Phobius: http://phobius.cbr.su.se/
*Combined transmembrane topology and signal peptide predictor

SignalP: http://www.cbs.dtu.dk/services/SignalP/
*Signal peptide predictor

PDB: https://www.rcsb.org/
*Protein data bank

Phyre2: http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index
*Protein fold recognition

ExPASy: https://expasy.org/proteomics
*Collection of proteomics resources

MEME suite: http://meme-suite.org/tools/meme
*Motif-based sequence analysis

===Sequence databases===

[https://www.embl.de EMBL]

[https://www.ncbi.nlm.nih.gov NCBI]

[https://img.jgi.doe.gov/ IMG/M]

[https://genome.jgi.doe.gov/portal/ JGI Genome Portal]

==Genomes==

[[File:Actinobase-icons-trans_Background.png|150px|Genomes|link=Genomes]]

[http://strepdb.streptomyces.org.uk/cgi-bin/dc3.pl?accession=AL645882&start=4291472&end=4302043&iorm=map&width=900 StrepDB]: the Streptomyces genome database curated by the [http://www.jic.ac.uk John Innes Centre], Norwich, UK.

[http://avermitilis.ls.kitasato-u.ac.jp Streptomyces avermitilis genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-coelicolor.html Streptomyces coelicolor genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-scabies.html Streptomyces scabies genome project]

==Suppliers==

[https://www.biost.com BioS&T]: custom made genome libraries including bacterial two hybrid and ePAC clone libraries for capturing complete biosynthetic gene clusters.

[http://www.mrdnalab.com Mr DNA]: for fast, cheap and reliable 16S, 18S & ITS rDNA amplicon sequencing for community profiling.

[https://www.vertis-biotech.com/Home Vertis Biotech]: cappable RNA-sequencing for mapping transcript start sites and all other RNA-seq techniques.

[https://www.dsmz.de DSMZ]: supplier of a broad variety of actinomycetes.

==[http://streptomyces.org.uk Additional Streptomyces resources including the StrepDB genome database]==

Links

2019-10-10T15:51:22Z

J Newitt:

=Useful Links=

==Bioinformatics==

===16S rRNA metaprofiling===

[https://greengenes.secondgenome.com Green Genes] 16S rRNA gene database

[https://www.arb-silva.de/ SILVA] 16S, 18S, SSU & LSU rRNA gene database

[http://qiime.org QIIME™] or [https://www.mothur.org Mothur] for analyzing 16S rRNA gene sequences.

===Genome-based taxonomic analysis===

[https://tygs.dsmz.de/ TYGS] Type (Strain) Genome Server

===DNA sequence analysis===

[https://www.ebi.ac.uk/Tools/msa/clustalo/ Clustal Omega sequence alignment]

[https://web.expasy.org/translate/ Expasy translate tool]

[http://meme-suite.org MEME: for identification of DNA binding sites in ChIP-seq data ]

[http://nc2.neb.com/NEBcutter2/ NEB Restriction enzyme cutter]

===Genome mining tools===

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

[https://antismash.secondarymetabolites.org/#!/start antiSMASH]:1 (antibiotics and Secondary Metabolite Analysis Shell)
*Identification and annotation of secondary metabolite gene clusters
*[https://twitter.com/antiSMASH_dev Twitter]

[http://grid.adapsyn.com/prism/#!/prism PRISM]:2 (PRediction Informatics for Secondary Metabolism)
*Identification of nonribosomal peptides, type I and II polyketides and RiPPs

[http://bagel4.molgenrug.nl/ BAGEL]:3
* Identification of gene clusters for bacteriocins and RiPPs

[https://omictools.com/clusean-tool CLUSEAN]:4
*Annotation and analysis of secondary metabolite gene clusters

[https://github.com/petercim/ClusterFinder ClusterFinder]:5
*Identification of secondary metabolite gene clusters

[https://arts3.ziemertlab.com/ ARTS]:6 (Antibiotic Resistant Target Seeker)
*Genome mining for secondary metabolites and potential antibiotics based on antibiotic resistance targets

[https://sourceforge.net/projects/secmetdb/ 2metDB]:7
*Genome mining for polyketides and nonribosomal peptides

[http://pks.kaist.ac.kr/pkminer/ PKMiner]:8
*Genome mining for type II polyketide synthases

[http://www.nii.ac.in/sbspks2.html SBSPKS]:9
*Sequence analysis of polyketide synthases

[http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php RiPPMINER]:10
*Genome mining and deciphering chemical structures of RiPPs

[http://www.ripprodeo.org/manual.html RODEO]:11 (Rapid ORF Description and Evaluation Online)
*Identification of biosynthetic gene clusters and prediction of RiPP precursor peptides

[https://github.com/streptomyces/ripper RiPPER]:12
*Identification of RiPP precursor peptides and biosynthetic gene clusters

[https://omictools.com/big-scape-tool BiG-SCAPE]

[https://github.com/nselem/EvoMining/wiki EvoMining]

====References====

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

===Protein & peptide analysis===

Useful resources for analysing protein and peptide features, structures and families:

STRING: https://string-db.org/
*Protein-Protein Interaction Networks

pFam: https://pfam.xfam.org/
*Database of protein families

Phobius: http://phobius.cbr.su.se/
*Combined transmembrane topology and signal peptide predictor

SignalP: http://www.cbs.dtu.dk/services/SignalP/
*Signal peptide predictor

PDB: https://www.rcsb.org/
*Protein data bank

Phyre2: http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index
*Protein fold recognition

ExPASy: https://expasy.org/proteomics
*Collection of proteomics resources

MEME suite: http://meme-suite.org/tools/meme
*Motif-based sequence analysis

===Sequence databases===

[https://www.embl.de EMBL]

[https://www.ncbi.nlm.nih.gov NCBI]

[https://img.jgi.doe.gov/ IMG/M]

[https://genome.jgi.doe.gov/portal/ JGI Genome Portal]

==Genomes==

[[File:Actinobase-icons-trans_Background.png|150px|Genomes|link=Genomes]]

[http://strepdb.streptomyces.org.uk/cgi-bin/dc3.pl?accession=AL645882&start=4291472&end=4302043&iorm=map&width=900 StrepDB]: the Streptomyces genome database curated by the [http://www.jic.ac.uk John Innes Centre], Norwich, UK.

[http://avermitilis.ls.kitasato-u.ac.jp Streptomyces avermitilis genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-coelicolor.html Streptomyces coelicolor genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-scabies.html Streptomyces scabies genome project]

==Suppliers==

[https://www.biost.com BioS&T]: custom made genome libraries including bacterial two hybrid and ePAC clone libraries for capturing complete biosynthetic gene clusters.

[http://www.mrdnalab.com Mr DNA]: for fast, cheap and reliable 16S, 18S & ITS rDNA amplicon sequencing for community profiling.

[https://www.vertis-biotech.com/Home Vertis Biotech]: cappable RNA-sequencing for mapping transcript start sites and all other RNA-seq techniques.

[https://www.dsmz.de DSMZ]: supplier of a broad variety of actinomycetes.

==[http://streptomyces.org.uk Additional Streptomyces resources including the StrepDB genome database]==

Links master page

2019-10-10T15:49:25Z

J Newitt:

=Useful Links=

==Bioinformatics==

===16S rRNA metaprofiling===

[https://greengenes.secondgenome.com Green Genes] 16S rRNA gene database

[https://www.arb-silva.de/ SILVA] 16S, 18S, SSU & LSU rRNA gene database

[http://qiime.org QIIME™] or [https://www.mothur.org Mothur] for analyzing 16S rRNA gene sequences.

===Genome-based taxonomic analysis===

[https://tygs.dsmz.de/ TYGS] Type (Strain) Genome Server

===DNA sequence analysis===

[https://www.ebi.ac.uk/Tools/msa/clustalo/ Clustal Omega sequence alignment]

[https://web.expasy.org/translate/ Expasy translate tool]

[http://meme-suite.org MEME: for identification of DNA binding sites in ChIP-seq data ]

[http://nc2.neb.com/NEBcutter2/ NEB Restriction enzyme cutter]

===Genome mining tools===

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

[https://antismash.secondarymetabolites.org/#!/start antiSMASH]:1 (antibiotics and Secondary Metabolite Analysis Shell)
*Identification and annotation of secondary metabolite gene clusters
*[https://twitter.com/antiSMASH_dev Twitter]

[http://grid.adapsyn.com/prism/#!/prism PRISM]:2 (PRediction Informatics for Secondary Metabolism)
*Identification of nonribosomal peptides, type I and II polyketides and RiPPs

[http://bagel4.molgenrug.nl/ BAGEL]:3
* Identification of gene clusters for bacteriocins and RiPPs

[https://omictools.com/clusean-tool CLUSEAN]:4
*Annotation and analysis of secondary metabolite gene clusters

[https://github.com/petercim/ClusterFinder ClusterFinder]:5
*Identification of secondary metabolite gene clusters

[https://arts3.ziemertlab.com/ ARTS]:6 (Antibiotic Resistant Target Seeker)
*Genome mining for secondary metabolites and potential antibiotics based on antibiotic resistance targets

[https://sourceforge.net/projects/secmetdb/ 2metDB]:7
*Genome mining for polyketides and nonribosomal peptides

[http://pks.kaist.ac.kr/pkminer/ PKMiner]:8
*Genome mining for type II polyketide synthases

[http://www.nii.ac.in/sbspks2.html SBSPKS]:9
*Sequence analysis of polyketide synthases

[http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php RiPPMINER]:10
*Genome mining and deciphering chemical structures of RiPPs

[http://www.ripprodeo.org/manual.html RODEO]:11 (Rapid ORF Description and Evaluation Online)
*Identification of biosynthetic gene clusters and prediction of RiPP precursor peptides

[https://github.com/streptomyces/ripper RiPPER]:12
*Identification of RiPP precursor peptides and biosynthetic gene clusters

[https://omictools.com/big-scape-tool BiG-SCAPE]

[https://github.com/nselem/EvoMining/wiki EvoMining]

====References====

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

===Protein & peptide analysis===

Useful resources for analysing protein and peptide features, structures and families:

STRING: https://string-db.org/
*Protein-Protein Interaction Networks

pFam: https://pfam.xfam.org/
*Database of protein families

Phobius: http://phobius.cbr.su.se/
*Combined transmembrane topology and signal peptide predictor

SignalP: http://www.cbs.dtu.dk/services/SignalP/
*Signal peptide predictor

PDB: https://www.rcsb.org/
*Protein data bank

Phyre2: http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index
*Protein fold recognition

ExPASy: https://expasy.org/proteomics
*Collection of proteomics resources

MEME suite: http://meme-suite.org/tools/meme
*Motif-based sequence analysis

===Sequence databases===

[https://www.embl.de EMBL]

[https://www.ncbi.nlm.nih.gov NCBI]

[https://img.jgi.doe.gov/ IMG/M]

[https://genome.jgi.doe.gov/portal/ JGI Genome Portal]

==Genomes==

[[File:Actinobase-icons-trans_Background.png|150px|Genomes|link=Genomes]]

[http://strepdb.streptomyces.org.uk/cgi-bin/dc3.pl?accession=AL645882&start=4291472&end=4302043&iorm=map&width=900 StrepDB]: the Streptomyces genome database curated by the [http://www.jic.ac.uk John Innes Centre], Norwich, UK.

[http://avermitilis.ls.kitasato-u.ac.jp Streptomyces avermitilis genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-coelicolor.html Streptomyces coelicolor genome project]

[https://www.sanger.ac.uk/resources/downloads/bacteria/streptomyces-scabies.html Streptomyces scabies genome project]

==Suppliers==

[https://www.biost.com BioS&T]: custom made genome libraries including bacterial two hybrid and ePAC clone libraries for capturing complete biosynthetic gene clusters.

[http://www.mrdnalab.com Mr DNA]: for fast, cheap and reliable 16S, 18S & ITS rDNA amplicon sequencing for community profiling.

[https://www.vertis-biotech.com/Home Vertis Biotech]: cappable RNA-sequencing for mapping transcript start sites and all other RNA-seq techniques.

[https://www.dsmz.de DSMZ]: supplier of a broad variety of actinomycetes.

==[http://streptomyces.org.uk Additional Streptomyces resources including the StrepDB genome database]==

Links master page

2019-10-10T15:45:54Z

J Newitt:

=Useful Links=

==Bioinformatics==

===16S rRNA metaprofiling===

[https://greengenes.secondgenome.com Green Genes] 16S rRNA gene database

[https://www.arb-silva.de/ SILVA] 16S, 18S, SSU & LSU rRNA gene database

[http://qiime.org QIIME™] or [https://www.mothur.org Mothur] for analyzing 16S rRNA gene sequences.

===Genome-based taxonomic analysis===

[https://tygs.dsmz.de/ TYGS] Type (Strain) Genome Server

===DNA sequence analysis===

[https://www.ebi.ac.uk/Tools/msa/clustalo/ Clustal Omega sequence alignment]

[https://web.expasy.org/translate/ Expasy translate tool]

[http://meme-suite.org MEME: for identification of DNA binding sites in ChIP-seq data ]

[http://nc2.neb.com/NEBcutter2/ NEB Restriction enzyme cutter]

===Genome mining tools===

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

[https://antismash.secondarymetabolites.org/#!/start antiSMASH]:1 (antibiotics and Secondary Metabolite Analysis Shell)
*Identification and annotation of secondary metabolite gene clusters
*[https://twitter.com/antiSMASH_dev Twitter]

[http://grid.adapsyn.com/prism/#!/prism PRISM]:2 (PRediction Informatics for Secondary Metabolism)
*Identification of nonribosomal peptides, type I and II polyketides and RiPPs

[http://bagel4.molgenrug.nl/ BAGEL]:3
* Identification of gene clusters for bacteriocins and RiPPs

[https://omictools.com/clusean-tool CLUSEAN]:4
*Annotation and analysis of secondary metabolite gene clusters

[https://github.com/petercim/ClusterFinder ClusterFinder]:5
*Identification of secondary metabolite gene clusters

[https://arts3.ziemertlab.com/ ARTS]:6 (Antibiotic Resistant Target Seeker)
*Genome mining for secondary metabolites and potential antibiotics based on antibiotic resistance targets

[https://sourceforge.net/projects/secmetdb/ 2metDB]:7
*Genome mining for polyketides and nonribosomal peptides

[http://pks.kaist.ac.kr/pkminer/ PKMiner]:8
*Genome mining for type II polyketide synthases

[http://www.nii.ac.in/sbspks2.html SBSPKS]:9
*Sequence analysis of polyketide synthases

[http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php RiPPMINER]:10
*Genome mining and deciphering chemical structures of RiPPs

[http://www.ripprodeo.org/manual.html RODEO]:11 (Rapid ORF Description and Evaluation Online)
*Identification of biosynthetic gene clusters and prediction of RiPP precursor peptides

[https://github.com/streptomyces/ripper RiPPER]:12
*Identification of RiPP precursor peptides and biosynthetic gene clusters

[https://omictools.com/big-scape-tool BiG-SCAPE]

[https://github.com/nselem/EvoMining/wiki EvoMining]

====References====

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

===Protein & peptide analysis===

Useful resources for analysing protein and peptide features, structures and families:

STRING: https://string-db.org/
*Protein-Protein Interaction Networks

pFam: https://pfam.xfam.org/
*Database of protein families

Phobius: http://phobius.cbr.su.se/
*Combined transmembrane topology and signal peptide predictor

SignalP: http://www.cbs.dtu.dk/services/SignalP/
*Signal peptide predictor

PDB: https://www.rcsb.org/
*Protein data bank

Phyre2: http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index
*Protein fold recognition

ExPASy: https://expasy.org/proteomics
*Collection of proteomics resources

MEME suite: http://meme-suite.org/tools/meme
*Motif-based sequence analysis

===Sequence databases===

[https://www.embl.de EMBL]

[https://www.ncbi.nlm.nih.gov NCBI]

[https://img.jgi.doe.gov/ IMG/M]

[https://genome.jgi.doe.gov/portal/ JGI Genome Portal]

Links master page

2019-10-10T15:44:15Z

J Newitt: Created page with "=Useful Links= ==Bioinformatics== ===16S rRNA metaprofiling=== [https://greengenes.secondgenome.com Green Genes] 16S rRNA gene database [https://www.arb-silva.de/ SILVA]..."

=Useful Links=

==Bioinformatics==

===16S rRNA metaprofiling===

[https://greengenes.secondgenome.com Green Genes] 16S rRNA gene database

[https://www.arb-silva.de/ SILVA] 16S, 18S, SSU & LSU rRNA gene database

[http://qiime.org QIIME™] or [https://www.mothur.org Mothur] for analyzing 16S rRNA gene sequences.

===Genome-based taxonomic analysis===

[https://tygs.dsmz.de/ TYGS] Type (Strain) Genome Server

===DNA sequence analysis===

[https://www.ebi.ac.uk/Tools/msa/clustalo/ Clustal Omega sequence alignment]

[https://web.expasy.org/translate/ Expasy translate tool]

[http://meme-suite.org MEME: for identification of DNA binding sites in ChIP-seq data ]

[http://nc2.neb.com/NEBcutter2/ NEB Restriction enzyme cutter]

===Genome mining tools===

Actinobacteria are talented producers of secondary metabolites, many of which have useful biological activities. Thanks to the development of many targeted genome mining tools for bacteria, we can now identify previously uncharacterised biosynthetic gene clusters (BGCs) for natural products.

Some useful genome mining resources are listed below:

[https://antismash.secondarymetabolites.org/#!/start antiSMASH]:1 (antibiotics and Secondary Metabolite Analysis Shell)
*Identification and annotation of secondary metabolite gene clusters
*[https://twitter.com/antiSMASH_dev Twitter]

[http://grid.adapsyn.com/prism/#!/prism PRISM]:2 (PRediction Informatics for Secondary Metabolism)
*Identification of nonribosomal peptides, type I and II polyketides and RiPPs

[http://bagel4.molgenrug.nl/ BAGEL]:3
* Identification of gene clusters for bacteriocins and RiPPs

[https://omictools.com/clusean-tool CLUSEAN]:4
*Annotation and analysis of secondary metabolite gene clusters

[https://github.com/petercim/ClusterFinder ClusterFinder]:5
*Identification of secondary metabolite gene clusters

[https://arts3.ziemertlab.com/ ARTS]:6 (Antibiotic Resistant Target Seeker)
*Genome mining for secondary metabolites and potential antibiotics based on antibiotic resistance targets

[https://sourceforge.net/projects/secmetdb/ 2metDB]:7
*Genome mining for polyketides and nonribosomal peptides

[http://pks.kaist.ac.kr/pkminer/ PKMiner]:8
*Genome mining for type II polyketide synthases

[http://www.nii.ac.in/sbspks2.html SBSPKS]:9
*Sequence analysis of polyketide synthases

[http://www.nii.ac.in/~priyesh/lantipepDB/new_predictions/index.php RiPPMINER]:10
*Genome mining and deciphering chemical structures of RiPPs

[http://www.ripprodeo.org/manual.html RODEO]:11 (Rapid ORF Description and Evaluation Online)
*Identification of biosynthetic gene clusters and prediction of RiPP precursor peptides

[https://github.com/streptomyces/ripper RiPPER]:12
*Identification of RiPP precursor peptides and biosynthetic gene clusters

[https://omictools.com/big-scape-tool BiG-SCAPE]

[https://github.com/nselem/EvoMining/wiki EvoMining]

# Medema, M.H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M.A., Weber, T., Takano, E., Breitling, R. (2011) antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic Acids Research, 1; 39 doi: 10.1093/nar/gkr466
# Skinnider, M.A., Merwin, N. J., Johnston, C. W., Magarvey, N. A. (2017) PRISM 3: expanded prediction of natural product chemical structures from microbial genomes. et al, Nucleic Acids Research, doi: 10.1093/nar/gkx320
# Van Heel, A.J., de Jong, A., Song, C., Viel, J. H., Kok, J., Kuipers, O. P. (2018) BAGEL4: a user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Research, 2;46 doi: org/10.1093/nar/gky383.
# Weber, T., Rausch, C., Lopez, P., Hoof, I., Gaykova, V., Huson, D. H., Wohlleben, W. (2009) CLUSEAN: a computer-based framework for the automated analysis of bacterial secondary metabolite biosynthetic gene clusters. Journal of Biotechnology, 140:13-7 doi: 10.1016/j.jbiotec.2009.01.007
# Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Wieland Brown, L.C., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., Takano, E., Sali, A., Linington, R.G., Fischbach, M.A. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. (2014) Cell, 158:412-21 doi: 10.1016/j.cell.2014.06.034
# Alanjary, M., Kronmiller, B., Adamek, M., Blin, K., Weber, T., Huson, D., Philmus, B., Ziemert, N. (2017) The Antibiotic Resistant Target Seeker (ARTS), an exploration engine for antibiotic cluster prioritization and novel drug target discovery. Nucleic Acids Research, 3;45(W1):W42-W48 doi: 10.1093/nar/gkx360
# Bachmann, B. O., and Ravel, J., (2009) Chapter 8. Methods for in silico prediction of microbial polyketide and nonribosomal peptide biosynthetic pathways from DNA sequence data. Methods in Enzymology, 458:181-217 doi: 10.1016/S0076-6879(09)04808-3
# Kim, J., and Yi, G.S. (2012) PKMiner: a database for exploring type II polyketide synthases. BMC Microbiology, 8;12:169. doi: 10.1186/1471-2180-12-169.
# Anand, S., Prasad, M.V., Yadav, G., Kumar, N., Shehara, J., Ansari, M.Z., Mohanty, D. (2010) SBSPKS: structure based sequence analysis of polyketide synthases. Nucleic Acids Research, 38(Web Server issue):W487-96. doi: 10.1093/nar/gkq340.
# Agrawal, P., Khater, S., Gupta, M., Sain, N., Mohanty, D. (2017) RiPPMiner: a bioinformatics resource for deciphering chemical structures of RiPPs based on prediction of cleavage and cross-links. Nucleic Acids Research, 3;45 doi: 10.1093/nar/gkx408.
# Tietz, J. I., Schwalen, C.J., Patel, P.S., Maxson, T., Blair, P.M., Tai, H.C., Zakai, U.I., Mitchell, D.A. (2017) A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nature Chemical Biology, 13(5):470-478 doi: 10.1038/nchembio.2319.
# Santos-Aberturas, J., Chandra, G., Frattaruolo, L., Lacret, R., Pham, T. H., Vior, N. M., Eyles, T. H., Truman, A. W. (2019) Uncovering the unexplored diversity of thioamidated ribosomal peptides in Actinobacteria using the RiPPER genome mining tool. Nucleic Acids Research, 47;(9):4624–4637 doi: 10.1093/nar/gkz192

===Protein & peptide analysis===

Useful resources for analysing protein and peptide features, structures and families:

STRING: https://string-db.org/
*Protein-Protein Interaction Networks

pFam: https://pfam.xfam.org/
*Database of protein families

Phobius: http://phobius.cbr.su.se/
*Combined transmembrane topology and signal peptide predictor

SignalP: http://www.cbs.dtu.dk/services/SignalP/
*Signal peptide predictor

PDB: https://www.rcsb.org/
*Protein data bank

Phyre2: http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index
*Protein fold recognition

ExPASy: https://expasy.org/proteomics
*Collection of proteomics resources

MEME suite: http://meme-suite.org/tools/meme
*Motif-based sequence analysis

===Sequence databases===

[https://www.embl.de EMBL]

[https://www.ncbi.nlm.nih.gov NCBI]

[https://img.jgi.doe.gov/ IMG/M]

[https://genome.jgi.doe.gov/portal/ JGI Genome Portal]

General Growth and Maintenance of Streptomyces sp.

2019-09-27T07:35:44Z

J Newitt: /* Growth of Streptomyces in liquid culture */

=General growth and maintenance of ''Streptomyces'' species=

''Streptomyces'' are multi-nuclear filamentous organisms that undergo several different stages of growth. This section will detail some of the practices that will help maintain healthy stocks of ''Streptomyces'' strains in the lab.

==Streaking for single colonies==
It may seem like a simple thing, but it is important when acquiring a strain for the first time to streak for single colonies before preparing your own [[spore stocks]]. The reason for this is that ''Streptomyces'' can be quite heterogeneous. Some of the colonies on a streakout plate may display abnormal morphology, such as developmental defects or pigment overproduction. It is important to pick colonies which are consistent with the population majority. This is especially important following any mutagenesis protocol, even though it may be tempting to assume that it is a mutant because it displays a phenotype.

''##Pictures of Streptomyces plate with aberrant colonies will be included shortly##''

==''Streptomyces'' life cycle==
The time taken to complete a full life cycle varies between ''Streptomyces'' strains but is generally between 3 and 10 days. Following innoculation of agar media with ''Streptomyces'' spores, small shiny colonies will appear. This is vegetative mycelia which grows into the media following germ tube formation after spore germination. The next stage of development sees aerial hyphae emerge. For most ''Streptomyces'' strains, this phase is characterised by a white fluffy appearance. The final stage of development sees a transition from aerial hyphae to highly hydrophobic spore chains, often characterised by the production of a spore pigment.

''##Pictures of Streptomyces development will be included shortly##''

==Growth of ''Streptomyces'' in liquid culture==
Most ''Streptomyces'' grow at 30° on solid and in liquid culture. Cultivating liquid cultures of ''Streptomyces'' with consistency can be problemlatic however due to the tendancy of many strains to form clumps of mycelium which rapidly fall out of suspension, making it difficult to quantify. There are exceptions to this, ''Streptomyces venezuelae'' is able to grow more consistently in liquid culture than most. Even with ''Streptomyces venezuelae'', it is recommended to grow Streptomyces in liquid culture with sterile springs or glass beads, in order to break up the mycelium. Liquid cultures should always be grown in a shaking incubator, usually between 200-250 RPM.

''##Pictures of Streptomyces cultures in spring flasks will be included shortly##''

==Notes==

==References==

General Growth and Maintenance of Streptomyces sp.

2019-09-27T07:33:55Z

J Newitt: /* Streptomyces life cycle */

=General growth and maintenance of ''Streptomyces'' species=

''Streptomyces'' are multi-nuclear filamentous organisms that undergo several different stages of growth. This section will detail some of the practices that will help maintain healthy stocks of ''Streptomyces'' strains in the lab.

==Streaking for single colonies==
It may seem like a simple thing, but it is important when acquiring a strain for the first time to streak for single colonies before preparing your own [[spore stocks]]. The reason for this is that ''Streptomyces'' can be quite heterogeneous. Some of the colonies on a streakout plate may display abnormal morphology, such as developmental defects or pigment overproduction. It is important to pick colonies which are consistent with the population majority. This is especially important following any mutagenesis protocol, even though it may be tempting to assume that it is a mutant because it displays a phenotype.

''##Pictures of Streptomyces plate with aberrant colonies will be included shortly##''

==''Streptomyces'' life cycle==
The time taken to complete a full life cycle varies between ''Streptomyces'' strains but is generally between 3 and 10 days. Following innoculation of agar media with ''Streptomyces'' spores, small shiny colonies will appear. This is vegetative mycelia which grows into the media following germ tube formation after spore germination. The next stage of development sees aerial hyphae emerge. For most ''Streptomyces'' strains, this phase is characterised by a white fluffy appearance. The final stage of development sees a transition from aerial hyphae to highly hydrophobic spore chains, often characterised by the production of a spore pigment.

''##Pictures of Streptomyces development will be included shortly##''

==Growth of ''Streptomyces'' in liquid culture==
Most ''Streptomyces'' grow at 30° on solid and in liquid culture. Cultivating liquid cultures of ''Streptomyces'' with consistency can be problemlatic however due to the tendancy of many strains to form clumps of mycelium which rapidly fall out of suspension, making it difficult to quantify. There are exceptions to this, ''Streptomyces venezuelae'' is able to grow more consistently in liquid culture than most. Even with ''Streptomyces venezuelae'', it is recommended to grow Streptomyces in liquid culture with sterile springs or glass beads. This helps break up the mycelium. Liquid cultures should always be grown in a shaking incubator, usually between 200-250 RPM.

''##Pictures of Streptomyces cultures in spring flasks will be included shortly##''

==Notes==

==References==

General Growth and Maintenance of Streptomyces sp.

2019-09-26T16:02:37Z

J Newitt:

=General growth and maintenance of ''Streptomyces'' species=

''Streptomyces'' are multi-nuclear filamentous organisms that undergo several different stages of growth. This section will detail some of the practices that will help maintain healthy stocks of ''Streptomyces'' strains in the lab.

==Streaking for single colonies==
It may seem like a simple thing, but it is important when acquiring a strain for the first time to streak for single colonies before preparing your own [[spore stocks]]. The reason for this is that ''Streptomyces'' can be quite heterogeneous. Some of the colonies on a streakout plate may display abnormal morphology, such as developmental defects or pigment overproduction. It is important to pick colonies which are consistent with the population majority. This is especially important following any mutagenesis protocol, even though it may be tempting to assume that it is a mutant because it displays a phenotype.

''##Pictures of Streptomyces plate with aberrant colonies will be included shortly##''

==''Streptomyces'' life cycle==
The time taken to complete a full life cycle varies between ''Streptomyces'' strains but is generally between 3 and 10 days. Following innoculation of agar media with ''Streptomyces'' spores, small shiny colonies will appear. This is vegetative mycelia which grows into the media following germ tube formation after spore germination. The next stage of development sees aerial hyphae emerge (after around 2-3 days for ''Streptomyces coelicolor'' on SFM). For most ''Streptomyces'' strains, this phase is characterised by a white fluffy appearance. The final stage of development sees a transition from aerial hyphae to spore chains, often characterised by the production of a highly hydrophobic spore pigment.

''##Pictures of Streptomyces development will be included shortly##''

==Growth of ''Streptomyces'' in liquid culture==
Most ''Streptomyces'' grow at 30° on solid and in liquid culture. Cultivating liquid cultures of ''Streptomyces'' with consistency can be problemlatic however due to the tendancy of many strains to form clumps of mycelium which rapidly fall out of suspension, making it difficult to quantify. There are exceptions to this, ''Streptomyces venezuelae'' is able to grow more consistently in liquid culture than most. Even with ''Streptomyces venezuelae'', it is recommended to grow Streptomyces in liquid culture with sterile springs or glass beads. This helps break up the mycelium. Liquid cultures should always be grown in a shaking incubator, usually between 200-250 RPM.

''##Pictures of Streptomyces cultures in spring flasks will be included shortly##''

==Notes==

==References==

General Growth and Maintenance of Streptomyces sp.

2019-09-26T16:01:51Z

J Newitt: Created page with "=General growth and maintenance of ''Streptomyces'' species= ''Streptomyces'' are multi-nuclear filamentous organisms that undergo several different stages of growth. This se..."

=General growth and maintenance of ''Streptomyces'' species=

''Streptomyces'' are multi-nuclear filamentous organisms that undergo several different stages of growth. This section will detail some of the practices that will help maintain healthy stocks of ''Streptomyces'' strains in the lab.

==Streaking for single colonies==
It may seem like a simple thing, but it is important when acquiring a strain for the first time to streak for single colonies before preparing your own [[spore stocks]]. The reason for this is that ''Streptomyces'' can be quite heterogeneous. Some of the colonies on a streakout plate may display abnormal morphology, such as developmental defects or pigment overproduction. It is important to pick colonies which are consistent with the population majority. This is especially important following any mutagenesis protocol, even though it may be tempting to assume that it is a mutant because it displays a phenotype.

''##Pictures of Streptomyces plate with aberrant colonies will be included shortly##''

==''Streptomyces life cycle''==
The time taken to complete a full life cycle varies between ''Streptomyces'' strains but is generally between 3 and 10 days. Following innoculation of agar media with ''Streptomyces'' spores, small shiny colonies will appear. This is vegetative mycelia which grows into the media following germ tube formation after spore germination. The next stage of development sees aerial hyphae emerge (after around 2-3 days for ''Streptomyces coelicolor'' on SFM). For most ''Streptomyces'' strains, this phase is characterised by a white fluffy appearance. The final stage of development sees a transition from aerial hyphae to spore chains, often characterised by the production of a highly hydrophobic spore pigment.

''##Pictures of Streptomyces development will be included shortly##''

==Growth of ''Streptomyces'' in liquid culture==
Most ''Streptomyces'' grow at 30° on solid and in liquid culture. Cultivating liquid cultures of ''Streptomyces'' with consistency can be problemlatic however due to the tendancy of many strains to form clumps of mycelium which rapidly fall out of suspension, making it difficult to quantify. There are exceptions to this, ''Streptomyces venezuelae'' is able to grow more consistently in liquid culture than most. Even with ''Streptomyces venezuelae'', it is recommended to grow Streptomyces in liquid culture with sterile springs or glass beads. This helps break up the mycelium. Liquid cultures should always be grown in a shaking incubator, usually between 200-250 RPM.

''##Pictures of Streptomyces cultures in spring flasks will be included shortly##''

==Notes==

==References==

PSS170

2019-08-29T15:51:51Z

J Newitt:

{{DISPLAYTITLE: pSS170}}

==Use==
pSS170 is used for introducing genes to ''Streptomyces''. Because this plasmid is lacking a promoter upstream of the multiple cloning site (MCS), the gene of interest is often cloned in with its native promoter, in order to complement a knockout mutant

==Features==
''Streptomyces'' phage phiBT1 integration site. Hygromycin resistance gene, oriT, ColEi origin of replication

==History==
Derived from pMS82 - https://www.addgene.org/68110/

==Map==

==Sequence links==

==References==
pMS82 background vector - Gregory, M.A., Till, R. and Smith, M.C., 2003. Integration site for Streptomyces phage φBT1 and development of site-specific integrating vectors. Journal of bacteriology, 185(17), pp.5320-5323.

Isolating Streptomyces from plant roots

2019-08-29T15:16:23Z

J Newitt: /* References */

{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}

=Sampling of plant roots for isolation of ''Streptomyces'' and other microorganisms from the plant rhizosphere and endosphere=

This method can be used to sample plant roots for total or selective bacterial isolation, as well as nucleic extraction for various experiments.

Depending on soil type and number of plants being sampled, this protocol can take up to a full day.

==Preparation and reagents needed==
*Phosphate buffer saline (PBS)
**6.33g NaH2PO4.H2O
**16.5g Na2HPO4.H2O
**1L dH2O
**Autoclave then add 200µl Silwett L-77
*Ethanol 100%
*Ethanol 70%
*50ml falcon tubes
*Sterile petri dishes
*Sterile micro centrifuge tubes (MCT)
*Sterile 10% glycerol
*Tweezers
*Sonicating water bath
*Disposable gloves

==Root sampling protocol==
#Set out foil and wipe down with 70% Ethanol
#Take plants from pots: shake off large soil particles in a gloved hand (make sure gloves have been disinfected with ethanol), cut off the stems aseptically.
#Put sampled roots into a 50ml tube containing 25ml of sterile PBS buffer. Wash on a shaker (30mins 180rpm) to remove particles. Alternatively, vortex vigorously for 20 seconds.
#Transfer the roots to a fresh tube of PBS, repeat step 3 (wash or vortex).
#If sampling rhizosphere, take the previous tube and centrifuge soil/PBS mixture at 3200g for 15 minutes to form a pellet. The resulting pellet can be resuspended in a smaller volume of PBS and diluted for spread plating, if the end goal is to isolate live bacteria. Alternatively, if the sampling is for nucleic acid isolation, snap freeze pellet in liquid nitrogen.
#Repeat steps 3 and 4 with the root samples until no further particles are removed by the washing.
#If there are still soil particles attached to the root, transfer to a sterile petri dish and remove as much soil debris as possible with ethanol flame sterilised tweezers.
#Transfer to a new falcon with PBS (25ml) and sonicate for 15-20 minutes in a sonicating water bath.
#If you are sampling from ''Arabidopsis'' roots, continue onto step 10 or 11. If you are sampling from thicker roots like ''Triticum aestivum'', see root sterilisation section below before continuing.
#For culturing endophytic bacteria: crush the roots in 1-2ml (depending on root size) in sterile 1G with a sterile pestle and mortar, transfer to an MCT. Make serial dilutions (0,-1,-2) and plate out onto replicate agar plates. It is possible to partially select for filamentous actinomycetes by plating on [[SFM]] with nystatin, cyclohexamide and naladixic acid.
#For DNA extraction from endophytic community, remove roots from PBS and separate into 2 samples for each plant. Snap freeze in liquid nitrogen and crush with a sterile mortar and pestle. Store at -80° until sample is extracted. Use MPBio fast spin kit for soil to extract from crushed roots.

==Wheat root sterilisation protocol==
#For sterilisation of wheat (''Triticum aestivum''), transfer the PBS washed roots into a falcon containing 10-20ml 70% ethonol and incubate at room temperature for 30 seconds.
#Transfer the roots to a fresh falcon tube containing 10-20ml 3% bleach solution and incubate at room temperature for 10 minutes.
#Pour off the bleach and wash with 10-20ml sterile dH2O at least 5 times. Continue to wash until the smell of bleach mostly dissipates.
#Continue with steps 10 or 11 of root sampling protocol above.

==Uses==
*Nucleic acid isolation for microbial community analysis
*General isolation of novel root associated microorganisms
*[[Plant root colonisation assay (preliminary)]]

==References==

Root sampling protocol adapted from:-
*Lebeis, S.L., Paredes, S.H., Lundberg, D.S., Breakfield, N., Gehring, J., McDonald, M., Malfatti, S., Del Rio, T.G., Jones, C.D., Tringe, S.G. and Dangl, J.L., 2015. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science, 349(6250), pp.860-864.
*Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S., Tremblay, J., Engelbrektson, A., Kunin, V., Del Rio, T.G. and Edgar, R.C., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature, 488(7409), p.86.
*Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E. and Peplies, J., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488(7409), p.91.
Wheat root sterilisation adapted from:-
*Larran, S., Perello, A., Simon, M.R. and Moreno, V., 2002. Isolation and analysis of endophytic microorganisms in wheat (Triticum aestivum L.) leaves. World Journal of Microbiology and Biotechnology, 18(7), pp.683-686.

Protocol adapted for ActinoBase by Jake T. Newitt from the University of East Anglia.

Isolating Streptomyces from plant roots

2019-08-15T15:34:34Z

J Newitt: /* Uses */

Isolating Streptomyces from plant roots

2019-08-15T15:27:44Z

J Newitt:

{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}

=Sampling of plant roots for isolation of ''Streptomyces'' and other microorganisms from the plant rhizosphere and endosphere=

This method can be used to sample plant roots for total or selective bacterial isolation, as well as nucleic extraction for various experiments.

Depending on soil type and number of plants being sampled, this protocol can take up to a full day.

==Preparation and reagents needed==
*Phosphate buffer saline (PBS)
**6.33g NaH2PO4.H2O
**16.5g Na2HPO4.H2O
**1L dH2O
**Autoclave then add 200µl Silwett L-77
*Ethanol 100%
*Ethanol 70%
*50ml falcon tubes
*Sterile petri dishes
*Sterile micro centrifuge tubes (MCT)
*Sterile 10% glycerol
*Tweezers
*Sonicating water bath
*Disposable gloves

==Root sampling protocol==
#Set out foil and wipe down with 70% Ethanol
#Take plants from pots: shake off large soil particles in a gloved hand (make sure gloves have been disinfected with ethanol), cut off the stems aseptically.
#Put sampled roots into a 50ml tube containing 25ml of sterile PBS buffer. Wash on a shaker (30mins 180rpm) to remove particles. Alternatively, vortex vigorously for 20 seconds.
#Transfer the roots to a fresh tube of PBS, repeat step 3 (wash or vortex).
#If sampling rhizosphere, take the previous tube and centrifuge soil/PBS mixture at 3200g for 15 minutes to form a pellet. The resulting pellet can be resuspended in a smaller volume of PBS and diluted for spread plating, if the end goal is to isolate live bacteria. Alternatively, if the sampling is for nucleic acid isolation, snap freeze pellet in liquid nitrogen.
#Repeat steps 3 and 4 with the root samples until no further particles are removed by the washing.
#If there are still soil particles attached to the root, transfer to a sterile petri dish and remove as much soil debris as possible with ethanol flame sterilised tweezers.
#Transfer to a new falcon with PBS (25ml) and sonicate for 15-20 minutes in a sonicating water bath.
#If you are sampling from ''Arabidopsis'' roots, continue onto step 10 or 11. If you are sampling from thicker roots like ''Triticum aestivum'', see root sterilisation section below before continuing.
#For culturing endophytic bacteria: crush the roots in 1-2ml (depending on root size) in sterile 1G with a sterile pestle and mortar, transfer to an MCT. Make serial dilutions (0,-1,-2) and plate out onto replicate agar plates. It is possible to partially select for filamentous actinomycetes by plating on [[SFM]] with nystatin, cyclohexamide and naladixic acid.
#For DNA extraction from endophytic community, remove roots from PBS and separate into 2 samples for each plant. Snap freeze in liquid nitrogen and crush with a sterile mortar and pestle. Store at -80° until sample is extracted. Use MPBio fast spin kit for soil to extract from crushed roots.

==Wheat root sterilisation protocol==
#For sterilisation of wheat (''Triticum aestivum''), transfer the PBS washed roots into a falcon containing 10-20ml 70% ethonol and incubate at room temperature for 30 seconds.
#Transfer the roots to a fresh falcon tube containing 10-20ml 3% bleach solution and incubate at room temperature for 10 minutes.
#Pour off the bleach and wash with 10-20ml sterile dH2O at least 5 times. Continue to wash until the smell of bleach mostly dissipates.
#Continue with steps 10 or 11 of root sampling protocol above.

==Uses==
*Nucleic acid isolation for microbial community analysis
*General isolation of novel root associated microorganisms
*[[Plant root colonisation assay (crude)]]

==References==

Root sampling protocol adapted from:-
*Lebeis, S.L., Paredes, S.H., Lundberg, D.S., Breakfield, N., Gehring, J., McDonald, M., Malfatti, S., Del Rio, T.G., Jones, C.D., Tringe, S.G. and Dangl, J.L., 2015. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science, 349(6250), pp.860-864.
*Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S., Tremblay, J., Engelbrektson, A., Kunin, V., Del Rio, T.G. and Edgar, R.C., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature, 488(7409), p.86.
*Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E. and Peplies, J., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488(7409), p.91.
Wheat root sterilisation adapted from:-
*Larran, S., Perello, A., Simon, M.R. and Moreno, V., 2002. Isolation and analysis of endophytic microorganisms in wheat (Triticum aestivum L.) leaves. World Journal of Microbiology and Biotechnology, 18(7), pp.683-686.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Isolating Streptomyces from plant roots

2019-08-14T17:42:34Z

J Newitt: /* Root sampling protocol */

{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}

=Sampling of plant roots for isolation of ''Streptomyces'' and other microorganisms from the plant rhizosphere and endosphere=

This method can be used to sample plant roots for total or selective bacterial isolation, as well as nucleic extraction for various experiments.

Depending on soil type and number of plants being sampled, this protocol can take up to a full day.

==Preparation and reagents needed==
*Phosphate buffer saline (PBS)
**6.33g NaH2PO4.H2O
**16.5g Na2HPO4.H2O
**1L dH2O
**Autoclave then add 200µl Silwett L-77
*Ethanol 100%
*Ethanol 70%
*50ml falcon tubes
*Sterile petri dishes
*Sterile micro centrifuge tubes (MCT)
*Sterile 10% glycerol
*Tweezers
*Sonicating water bath
*Disposable gloves

==Root sampling protocol==
#Set out foil and wipe down with 70% Ethanol
#Take plants from pots: shake off large soil particles in a gloved hand (make sure gloves have been disinfected with ethanol), cut off the stems aseptically.
#Put sampled roots into a 50ml tube containing 25ml of sterile PBS buffer. Wash on a shaker (30mins 180rpm) to remove particles. Alternatively, vortex vigorously for 20 seconds.
#Transfer the roots to a fresh tube of PBS, repeat step 3 (wash or vortex).
#If sampling rhizosphere, take the previous tube and centrifuge soil/PBS mixture at 3200g for 15 minutes to form a pellet. The resulting pellet can be resuspended in a smaller volume of PBS and diluted for spread plating, if the end goal is to isolate live bacteria. Alternatively, if the sampling is for nucleic acid isolation, snap freeze pellet in liquid nitrogen.
#Repeat steps 3 and 4 with the root samples until no further particles are removed by the washing.
#If there are still soil particles attached to the root, transfer to a sterile petri dish and remove as much soil debris as possible with ethanol flame sterilised tweezers.
#Transfer to a new falcon with PBS (25ml) and sonicate for 15-20 minutes in a sonicating water bath.
#If you are sampling from ''Arabidopsis'' roots, continue onto step 10 or 11. If you are sampling from thicker roots like ''Triticum aestivum'', see root sterilisation section below before continuing.
#For culturing endophytic bacteria: crush the roots in 1-2ml (depending on root size) in sterile 1G with a sterile pestle and mortar, transfer to an MCT. Make serial dilutions (0,-1,-2) and plate out onto replicate agar plates. [[SFM]] is generally a good media to use for the isolation of Actinomycetes.
#For DNA extraction from endophytic community, remove roots from PBS and separate into 2 samples for each plant. Snap freeze in liquid nitrogen and crush with a sterile mortar and pestle. Store at -80° until sample is extracted. Use MPBio fast spin kit for soil to extract from crushed roots.

==Root sterilisation protocol==
#For sterilisation of wheat (''Triticum aestivum''), transfer the PBS washed roots into a falcon containing 10-20ml 70% ethonol and incubate at room temperature for 30 seconds.
#Transfer the roots to a fresh falcon tube containing 10-20ml 3% bleach solution and incubate at room temperature for 10 minutes.
#Pour off the bleach and wash with 10-20ml sterile dH2O at least 5 times. Continue to wash until the smell of bleach mostly dissipates.
#Continue with steps 10 or 11 of root sampling protocol above.

==Uses==
*[[Nucleic acid isolation for microbial community analysis]]
*[[Isolation of novel root associated microorganisms]]
*[[Plant root colonisation assay (crude)]]

==References==

Root sampling protocol adapted from:-
*Lebeis, S.L., Paredes, S.H., Lundberg, D.S., Breakfield, N., Gehring, J., McDonald, M., Malfatti, S., Del Rio, T.G., Jones, C.D., Tringe, S.G. and Dangl, J.L., 2015. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science, 349(6250), pp.860-864.
*Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S., Tremblay, J., Engelbrektson, A., Kunin, V., Del Rio, T.G. and Edgar, R.C., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature, 488(7409), p.86.
*Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E. and Peplies, J., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488(7409), p.91.
Wheat root sterilisation adapted from:-
*Larran, S., Perello, A., Simon, M.R. and Moreno, V., 2002. Isolation and analysis of endophytic microorganisms in wheat (Triticum aestivum L.) leaves. World Journal of Microbiology and Biotechnology, 18(7), pp.683-686.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Isolating Streptomyces from plant roots

2019-08-14T17:40:45Z

J Newitt: /* Root sampling protocol */

{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}

=Sampling of plant roots for isolation of ''Streptomyces'' and other microorganisms from the plant rhizosphere and endosphere=

This method can be used to sample plant roots for total or selective bacterial isolation, as well as nucleic extraction for various experiments.

Depending on soil type and number of plants being sampled, this protocol can take up to a full day.

==Preparation and reagents needed==
*Phosphate buffer saline (PBS)
**6.33g NaH2PO4.H2O
**16.5g Na2HPO4.H2O
**1L dH2O
**Autoclave then add 200µl Silwett L-77
*Ethanol 100%
*Ethanol 70%
*50ml falcon tubes
*Sterile petri dishes
*Sterile micro centrifuge tubes (MCT)
*Sterile 10% glycerol
*Tweezers
*Sonicating water bath
*Disposable gloves

==Root sampling protocol==
#Set out foil and wipe down with 70% Ethanol
#Take plants from pots: shake off large soil particles in a gloved hand (make sure gloves have been disinfected with ethanol), cut off the stems aseptically.
#Put sampled roots into a 50ml tube containing 25ml of sterile PBS buffer. Wash on a shaker (30mins 180rpm) to remove particles. Alternatively, vortex vigorously for 20 seconds.
#Transfer the roots to a fresh tube of PBS, repeat step 3 (wash or vortex).
#If sampling rhizosphere, take the previous tube and centrifuge soil/PBS mixture at 3200g for 15 minutes to form a pellet. The resulting pellet can be resuspended in a smaller volume of PBS and diluted for spread plating, if the end goal is to isolate live bacteria. Alternatively, if the sampling is for nucleic acid isolation, snap freeze pellet in liquid nitrogen.
#Repeat steps 3 and 4 with the root samples until no further particles are removed by the washing.
#If there are still soil particles attached to the root, transfer to a sterile petri dish and remove as much soil debris as possible with ethanol flame sterilised tweezers.
#Transfer to a new falcon with PBS (25ml) and sonicate for 15-20 minutes in a sonicating water bath.
#If you are sampling from ''Arabidopsis'' roots, continue onto step 10 or 11. If you are sampling from thicker roots like ''Triticum aestivum'', see root sterilisation section below before continuing.
#For culturing endophytic bacteria: crush the roots in 1-2ml (depending on root size) in sterile 1G with a sterile pestle and mortar, transfer to an MCT. Make serial dilutions (0,-1,-2). Plate out onto replicate agar plates. [[SFM]] is generally a good media to use for the isolation of Actinomycetes.
#For DNA extraction from endophytic community, remove roots from PBS and separate into 2 samples for each plant. Snap freeze in liquid nitrogen and crush with a sterile mortar and pestle. Store at -80° until sample is extracted. Use MPBio fast spin kit for soil to extract from crushed roots.

==Root sterilisation protocol==
#For sterilisation of wheat (''Triticum aestivum''), transfer the PBS washed roots into a falcon containing 10-20ml 70% ethonol and incubate at room temperature for 30 seconds.
#Transfer the roots to a fresh falcon tube containing 10-20ml 3% bleach solution and incubate at room temperature for 10 minutes.
#Pour off the bleach and wash with 10-20ml sterile dH2O at least 5 times. Continue to wash until the smell of bleach mostly dissipates.
#Continue with steps 10 or 11 of root sampling protocol above.

==Uses==
*[[Nucleic acid isolation for microbial community analysis]]
*[[Isolation of novel root associated microorganisms]]
*[[Plant root colonisation assay (crude)]]

==References==

Root sampling protocol adapted from:-
*Lebeis, S.L., Paredes, S.H., Lundberg, D.S., Breakfield, N., Gehring, J., McDonald, M., Malfatti, S., Del Rio, T.G., Jones, C.D., Tringe, S.G. and Dangl, J.L., 2015. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science, 349(6250), pp.860-864.
*Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S., Tremblay, J., Engelbrektson, A., Kunin, V., Del Rio, T.G. and Edgar, R.C., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature, 488(7409), p.86.
*Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E. and Peplies, J., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488(7409), p.91.
Wheat root sterilisation adapted from:-
*Larran, S., Perello, A., Simon, M.R. and Moreno, V., 2002. Isolation and analysis of endophytic microorganisms in wheat (Triticum aestivum L.) leaves. World Journal of Microbiology and Biotechnology, 18(7), pp.683-686.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Isolating Streptomyces from plant roots

2019-08-14T17:34:03Z

J Newitt: /* Sampling of plant roots to isolate Streptomyces from rhizosphere and endosphere compartments */

{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}

=Sampling of plant roots for isolation of ''Streptomyces'' and other microorganisms from the plant rhizosphere and endosphere=

This method can be used to sample plant roots for total or selective bacterial isolation, as well as nucleic extraction for various experiments.

Depending on soil type and number of plants being sampled, this protocol can take up to a full day.

==Preparation and reagents needed==
*Phosphate buffer saline (PBS)
**6.33g NaH2PO4.H2O
**16.5g Na2HPO4.H2O
**1L dH2O
**Autoclave then add 200µl Silwett L-77
*Ethanol 100%
*Ethanol 70%
*50ml falcon tubes
*Sterile petri dishes
*Sterile micro centrifuge tubes (MCT)
*Sterile 10% glycerol
*Tweezers
*Sonicating water bath
*Disposable gloves

==Root sampling protocol==
#Set out foil and wipe down with 70% Ethanol
#Take plants from pots: shake off large soil particles in a gloved hand (make sure gloves have been disinfected with ethanol), cut off the stems aseptically.
#Put sampled roots into a 50ml tube containing 25ml of sterile PBS buffer. Wash on a shaker (30mins 180rpm) to remove particles. Alternatively, vortex vigorously for 20 seconds.
#Transfer the roots to a fresh tube of PBS, repeat step 3 (wash or vortex).
#If sampling rhizosphere, take the previous tube and centrifuge soil/PBS mixture at 3200g for 15 minutes to form a pellet. The resulting pellet can be resuspended in a smaller volume of PBS and diluted for spread plating, if the end goal is to isolate live bacteria. Alternatively, if the sampling is for nucleic acid isolation, snap freeze pellet in liquid nitrogen.
#Repeat steps 3 and 4 until no further particles are removed by the washing.
#If there are still soil particles attached to the root, transfer to a sterile petri dish and remove as much soil debris as possible with ethanol flame sterilised tweezers.
#Transfer to new falcon with PBS (25ml) and sonicate for 15-20 minutes in a sonicating water bath.
#If you are sampling from ''Arabidopsis'' roots, continue onto step 10 or 11. If you are sampling from thicker roots like ''Triticum aestivum'', see root sterilisation section below before continuing.
#For culturing endophytic bacteria: crush the roots in 1ml sterile 1G in sterile pestle and mortars, place in eppendorfs. Make serial dilutions (0,-1,-2). Plate out onto replicate agar plates.
#For DNA extraction from endophytic community instead: remove roots from PBS. Separate into 2 samples for each plant and snap freeze, place at -80 degrees. Use MPBio fast spin kit for soil to extract from crushed roots.

==Root sterilisation protocol==
#For sterilisation of wheat (''Triticum aestivum''), transfer the PBS washed roots into a falcon containing 10-20ml 70% ethonol and incubate at room temperature for 30 seconds.
#Transfer the roots to a fresh falcon tube containing 10-20ml 3% bleach solution and incubate at room temperature for 10 minutes.
#Pour off the bleach and wash with 10-20ml sterile dH2O at least 5 times. Continue to wash until the smell of bleach mostly dissipates.
#Continue with steps 10 or 11 of root sampling protocol above.

==Uses==
*[[Nucleic acid isolation for microbial community analysis]]
*[[Isolation of novel root associated microorganisms]]
*[[Plant root colonisation assay (crude)]]

==References==

Root sampling protocol adapted from:-
*Lebeis, S.L., Paredes, S.H., Lundberg, D.S., Breakfield, N., Gehring, J., McDonald, M., Malfatti, S., Del Rio, T.G., Jones, C.D., Tringe, S.G. and Dangl, J.L., 2015. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science, 349(6250), pp.860-864.
*Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S., Tremblay, J., Engelbrektson, A., Kunin, V., Del Rio, T.G. and Edgar, R.C., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature, 488(7409), p.86.
*Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E. and Peplies, J., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488(7409), p.91.
Wheat root sterilisation adapted from:-
*Larran, S., Perello, A., Simon, M.R. and Moreno, V., 2002. Isolation and analysis of endophytic microorganisms in wheat (Triticum aestivum L.) leaves. World Journal of Microbiology and Biotechnology, 18(7), pp.683-686.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Isolating Streptomyces from plant roots

2019-08-14T17:31:40Z

J Newitt:

{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}

=Sampling of plant roots to isolate ''Streptomyces'' from rhizosphere and endosphere compartments=

This method can be used to sample plant roots for the total or selective bacterial isolation, as well as nucleic extraction for various experiments.

Depending on soil type and number of plants being samples, this protocol can take up to a full day.

==Preparation and reagents needed==
*Phosphate buffer saline (PBS)
**6.33g NaH2PO4.H2O
**16.5g Na2HPO4.H2O
**1L dH2O
**Autoclave then add 200µl Silwett L-77
*Ethanol 100%
*Ethanol 70%
*50ml falcon tubes
*Sterile petri dishes
*Sterile micro centrifuge tubes (MCT)
*Sterile 10% glycerol
*Tweezers
*Sonicating water bath
*Disposable gloves

==Root sampling protocol==
#Set out foil and wipe down with 70% Ethanol
#Take plants from pots: shake off large soil particles in a gloved hand (make sure gloves have been disinfected with ethanol), cut off the stems aseptically.
#Put sampled roots into a 50ml tube containing 25ml of sterile PBS buffer. Wash on a shaker (30mins 180rpm) to remove particles. Alternatively, vortex vigorously for 20 seconds.
#Transfer the roots to a fresh tube of PBS, repeat step 3 (wash or vortex).
#If sampling rhizosphere, take the previous tube and centrifuge soil/PBS mixture at 3200g for 15 minutes to form a pellet. The resulting pellet can be resuspended in a smaller volume of PBS and diluted for spread plating, if the end goal is to isolate live bacteria. Alternatively, if the sampling is for nucleic acid isolation, snap freeze pellet in liquid nitrogen.
#Repeat steps 3 and 4 until no further particles are removed by the washing.
#If there are still soil particles attached to the root, transfer to a sterile petri dish and remove as much soil debris as possible with ethanol flame sterilised tweezers.
#Transfer to new falcon with PBS (25ml) and sonicate for 15-20 minutes in a sonicating water bath.
#If you are sampling from ''Arabidopsis'' roots, continue onto step 10 or 11. If you are sampling from thicker roots like ''Triticum aestivum'', see root sterilisation section below before continuing.
#For culturing endophytic bacteria: crush the roots in 1ml sterile 1G in sterile pestle and mortars, place in eppendorfs. Make serial dilutions (0,-1,-2). Plate out onto replicate agar plates.
#For DNA extraction from endophytic community instead: remove roots from PBS. Separate into 2 samples for each plant and snap freeze, place at -80 degrees. Use MPBio fast spin kit for soil to extract from crushed roots.

==Root sterilisation protocol==
#For sterilisation of wheat (''Triticum aestivum''), transfer the PBS washed roots into a falcon containing 10-20ml 70% ethonol and incubate at room temperature for 30 seconds.
#Transfer the roots to a fresh falcon tube containing 10-20ml 3% bleach solution and incubate at room temperature for 10 minutes.
#Pour off the bleach and wash with 10-20ml sterile dH2O at least 5 times. Continue to wash until the smell of bleach mostly dissipates.
#Continue with steps 10 or 11 of root sampling protocol above.

==Uses==
*[[Nucleic acid isolation for microbial community analysis]]
*[[Isolation of novel root associated microorganisms]]
*[[Plant root colonisation assay (crude)]]

==References==

Root sampling protocol adapted from:-
*Lebeis, S.L., Paredes, S.H., Lundberg, D.S., Breakfield, N., Gehring, J., McDonald, M., Malfatti, S., Del Rio, T.G., Jones, C.D., Tringe, S.G. and Dangl, J.L., 2015. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science, 349(6250), pp.860-864.
*Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S., Tremblay, J., Engelbrektson, A., Kunin, V., Del Rio, T.G. and Edgar, R.C., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature, 488(7409), p.86.
*Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E. and Peplies, J., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488(7409), p.91.
Wheat root sterilisation adapted from:-
*Larran, S., Perello, A., Simon, M.R. and Moreno, V., 2002. Isolation and analysis of endophytic microorganisms in wheat (Triticum aestivum L.) leaves. World Journal of Microbiology and Biotechnology, 18(7), pp.683-686.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Isolating Streptomyces from plant roots

2019-08-14T17:23:39Z

J Newitt:

{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}

=Sampling of plant roots to isolate ''Streptomyces'' from rhizosphere and endosphere compartments=

This method can be used to sample plant roots for the total or selective bacterial isolation, as well as nucleic extraction for various experiments.

Depending on soil type and number of plants being samples, this protocol can take up to a full day.

==Preparation and reagents needed==
*Phosphate buffer saline (PBS)
**6.33g NaH2PO4.H2O
**16.5g Na2HPO4.H2O
**1L dH2O
**Autoclave then add 200µl Silwett L-77
*Ethanol 100%
*Ethanol 70%
*50ml falcon tubes
*Sterile petri dishes
*Sterile micro centrifuge tubes (MCT)
*Sterile 10% glycerol
*Tweezers
*Sonicating water bath
*Disposable gloves

'''Instructions'''
#Set out foil and wipe down with 70% Ethanol
#Take plants from pots: shake off large soil particles in a gloved hand (make sure gloves have been disinfected with ethanol), cut off the stems aseptically.
#Put sampled roots into a 50ml tube containing 25ml of sterile PBS buffer. Wash on a shaker (30mins 180rpm) to remove particles. Alternatively, vortex vigorously for 20 seconds.
#Transfer the roots to a fresh tube of PBS, repeat step 3 (wash or vortex).
#If sampling rhizosphere, take the previous tube and centrifuge soil/PBS mixture at 3200g for 15 minutes to form a pellet. The resulting pellet can be resuspended in a smaller volume of PBS and diluted for spread plating, if the end goal is to isolate live bacteria. Alternatively, if the sampling is for nucleic acid isolation, snap freeze pellet in liquid nitrogen.
#Repeat steps 3 and 4 until no further particles are removed by the washing.
#If there are still soil particles attached to the root, transfer to a sterile petri dish and remove as much soil debris as possible with ethanol flame sterilised tweezers.
#Transfer to new falcon with PBS (25ml) and sonicate for 15-20 minutes in a sonicating water bath.
#If you are sampling from ''Arabidopsis'' roots, continue onto step 10 or 11. If you are sampling from thicker roots like ''Triticum aestivum'', see root sterilisation section below before continuing.
#For culturing endophytic bacteria: crush the roots in 1ml sterile 1G in sterile pestle and mortars, place in eppendorfs. Make serial dilutions (0,-1,-2). Plate out onto replicate agar plates.
#For DNA extraction from endophytic community instead: remove roots from PBS. Separate into 2 samples for each plant and snap freeze, place at -80 degrees. Use MPBio fast spin kit for soil to extract from crushed roots.

'''Root sterilisation'''
#For sterilisation of wheat (''Triticum aestivum''), transfer the PBS washed roots into a falcon containing 10-20ml 70% ethonol and incubate at room temperature for 30 seconds.
#Transfer the roots to a fresh falcon tube containing 10-20ml 3% bleach solution and incubate at room temperature for 10 minutes.
#Pour off the bleach and wash with 10-20ml sterile dH2O at least 5 times. Continue to wash until the smell of bleach mostly dissipates.
#Continue with steps 10 or 11 of root sampling protocol above.

==Uses==
*[[Nucleic acid isolation for microbial community analysis]]
*[[Isolation of novel root associated microorganisms]]
*[[Plant root colonisation assay (crude)]]

==Notes==
For growth in liquid culture, [[DNA]] can be made without the agar ([[DNB]]).

==References==

Root sampling protocol adapted from:-
*Lebeis, S.L., Paredes, S.H., Lundberg, D.S., Breakfield, N., Gehring, J., McDonald, M., Malfatti, S., Del Rio, T.G., Jones, C.D., Tringe, S.G. and Dangl, J.L., 2015. Salicylic acid modulates colonization of the root microbiome by specific bacterial taxa. Science, 349(6250), pp.860-864.
*Lundberg, D.S., Lebeis, S.L., Paredes, S.H., Yourstone, S., Gehring, J., Malfatti, S., Tremblay, J., Engelbrektson, A., Kunin, V., Del Rio, T.G. and Edgar, R.C., 2012. Defining the core Arabidopsis thaliana root microbiome. Nature, 488(7409), p.86.
*Bulgarelli, D., Rott, M., Schlaeppi, K., van Themaat, E.V.L., Ahmadinejad, N., Assenza, F., Rauf, P., Huettel, B., Reinhardt, R., Schmelzer, E. and Peplies, J., 2012. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488(7409), p.91.
Wheat root sterilisation adapted from:-
*

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Salting Out Genomic DNA Extraction Method

2019-08-14T15:11:53Z

J Newitt:

=Isolation of high molecular weight (HMW) genomic DNA by salting out=

The salting out method is used to isolate high yields of high molecular weight DNA, usually for applications such as whole genome sequencing. It is particularly useful for long read sequencing such as PacBIO and Nanopore, as ''Streptomyces'' has long regions of repetitive DNA sequences.

It is recommended that a whole day is allocated for this protocol, particularly if it is the first time conducting it.

==Preparation and reagents needed==
*Mycelium from 25ml culture (split a 50ml culture into 2)
*SET buffer:- 75mM NaCl, 25mM EDTA pH8, 20mM Tris-HCl pH7.5
*Lysozyme:- 50mg ml-1
*Proteinase K:- 20mg ml-1
*SDS:- 10%
*NaCl:- 5M
*Isopropanol
*70% Ethanol
*TE buffer of sterilised dH2O
*Sealed Pateur pipette
*Eppendorf tubes
*10ml pipettes
*Yellow tips/blue tips and P200/P1000 pipette
*5ml or 10ml pipette

'''Instructions'''
#Resuspend mycelium in 5ml SET buffer in a 50ml falcon tube. Add 100µl of lysozyme solution. Incubate at 37 degrees C°
#Add 140µl proteinase K solution and 600µl 10% SDS, then mix by inversion. Incubate at 55° for 2 hours and invert occasionally
#Add 2ml 5M NaCl and mix by inversion
#Allow to temperature to cool to 37° or lower before adding 5ml chloroform. Mix by inversion for 30 minutes at 20°
#Centrifuge at 4500g for 15 minutes at 20°
#Carefully remove the top layer with a cut pipette tip and transfer to a clean tube. If the solution is still opaque, consider adding more NaCl, SDS and Chloroform as per steps 2-4 and repeat step 5
#The solution should be incubated on ice for 2 minutes, before adding 0.6 vol ice cold isopropanol. Mix by inversion and continue to incubate on ice for around 3 minutes. Spool DNA onto a sealed pasteur pipette
#Rinse DNA in 5ml 70% ethanol and leave to air dry. Using cut tips, resuspend in 500µl of TE or sterilised dH2O

==Uses==
*[[Whole Genome Sequencing]]
*[[Template Generation for PCR]]

==Notes==
For growth in liquid culture, [[DNA]] can be made without the agar ([[DNB]]).

==References==

Adapted from Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F. and Hopwood, D.A., 2000. Practical ''Streptomyces'' genetics (Vol. 291). Norwich: John Innes Foundation.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Isolating Streptomyces from plant roots

2019-08-14T14:44:56Z

J Newitt: Created page with "{{DISPLAYTITLE: Isolating ''Streptomyces'' from plant roots}}"

Isolating Actinomycetes from the environment

2019-08-14T14:39:46Z

J Newitt: Created page with "Isolating ''Streptomyces'' from plant roots"

[[Isolating ''Streptomyces'' from plant roots]]

Protocols

2019-08-14T14:38:11Z

J Newitt:

[[File:Actinobase-icons-trans_Protocols.png|150px|Protocols|link=Protocols]]

[[Cloning, Transformation and Expression of Gene Clusters]]

[[CRISPR/Cas9-mediated genome editing]]

[[General Growth and Maintenance of Streptomyces sp.]]

[[High GC PCR]]

[[Mutagenesis]]

[[Nucleic Acid Methods]]

[[Protein Methods]]

[[Microscopy]]

[[Isolating Actinomycetes from the environment]]

Salting Out Genomic DNA Extraction Method

2019-08-14T14:21:31Z

J Newitt:

=Isolation of high molecular weight (HMW) genomic DNA by salting out=

The salting out method is used to isolate high yields of high molecular weight DNA, usually for applications such as whole genome sequencing. It is particularly useful for long read sequencing such as PacBIO and Nanopore, as ''Streptomyces'' has long regions of repetitive DNA sequences.

It is recommended that a whole day is allocated for this protocol, particularly if it is the first time conducting it.

==Preparation and reagents needed==
#Mycelium from 25ml culture (split a 50ml culture into 2)
#SET buffer:- 75mM NaCl, 25mM EDTA pH8, 20mM Tris-HCl pH7.5
#Lysozyme:- 50mg ml-1
#Proteinase K:- 20mg ml-1
#SDS:- 10%
#NaCl:- 5M
#Isopropanol
#70% Ethanol
#TE buffer of sterilised dH2O
#Sealed Pateur pipette
#Eppendorf tubes
#10ml pipettes
#Yellow tips/blue tips and P200/P1000 pipette
#5ml or 10ml pipette

'''Instructions'''
#Resuspend mycelium in 5ml SET buffer in a 50ml falcon tube. Add 100µl of lysozyme solution. Incubate at 37 degrees C°
#Add 140µl proteinase K solution and 600µl 10% SDS, then mix by inversion. Incubate at 55° for 2 hours and invert occasionally
#Add 2ml 5M NaCl and mix by inversion
#Allow to temperature to cool to 37° or lower before adding 5ml chloroform. Mix by inversion for 30 minutes at 20°
#Centrifuge at 4500g for 15 minutes at 20°
#Carefully remove the top layer with a cut pipette tip and transfer to a clean tube. If the solution is still opaque, consider adding more NaCl, SDS and Chloroform as per steps 2-4 and repeat step 5
#The solution should be incubated on ice for 2 minutes, before adding 0.6 vol ice cold isopropanol. Mix by inversion and continue to incubate on ice for around 3 minutes. Spool DNA onto a sealed pasteur pipette
#Rinse DNA in 5ml 70% ethanol and leave to air dry. Using cut tips, resuspend in 500µl of TE or sterilised dH2O

==Uses==
*[[Whole Genome Sequencing]]
*[[Template Generation for PCR]]

==Notes==
For growth in liquid culture, [[DNA]] can be made without the agar ([[DNB]]).

==References==

Adapted from Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F. and Hopwood, D.A., 2000. Practical ''Streptomyces'' genetics (Vol. 291). Norwich: John Innes Foundation.

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Salting Out Genomic DNA Extraction Method

2019-08-14T14:18:31Z

J Newitt:

=Isolation of high molecular weight (HMW) genomic DNA by salting out=

The salting out method is used to isolate high yields of high molecular weight DNA, usually for applications such as whole genome sequencing. It is particularly useful for long read sequencing such as PacBIO and nanopore, as ''Streptomyces'' has long regions of repeatitive DNA sequences.

It is recommended that a whole day is allocated for this protocol, particularly if it is the first time conducting it.

==Preparation and reagents needed==
#Mycelium from 25ml culture (split a 50ml culture into 2)
#SET buffer:- 75mM NaCl, 25mM EDTA pH8, 20mM Tris-HCl pH7.5
#Lysozyme:- 50mg ml-1
#Proteinase K:- 20mg ml-1
#SDS:- 10%
#NaCl:- 5M
#Isopropanol
#70% Ethanol
#TE buffer of sterilised dH2O
#Sealed Pateur pipette
#Eppendorf tubes
#10ml pipettes
#Yellow tips/blue tips and P200/P1000 pipette
#5ml or 10ml pipette

'''Instructions'''
#Resuspend mycelium in 5ml SET buffer in a 50ml falcon tube. Add 100µl of lysozyme solution. Incubate at 37 degrees C°
#Add 140µl proteinase K solution and 600µl 10% SDS, then mix by inversion. Incubate at 55° for 2 hours and invert occasionally
#Add 2ml 5M NaCl and mix by inversion
#Allow to temperature to cool to 37° or lower before adding 5ml chloroform. Mix by inversion for 30 minutes at 20°
#Centrifuge at 4500g for 15 minutes at 20°
#Carefully remove the top layer with a cut pipette tip and transfer to a clean tube. If the solution is still opaque, consider adding more NaCl, SDS and Chloroform as per steps 2-4 and repeat step 5
#The solution should be incubated on ice for 2 minutes, before adding 0.6 vol ice cold isopropanol. Mix by inversion and continue to incubate on ice for around 3 minutes. Spool DNA onto a sealed pasteur pipette
#Rinse DNA in 5ml 70% ethanol and leave to air dry. Using cut tips, resuspend in 500µl of TE or sterilised dH2O

==Uses==
*[[Whole Genome Sequencing]]
*[[Template Generation for PCR]]

==Notes==
For growth in liquid culture, [[DNA]] can be made without the agar ([[DNB]]).

==References==

Protocol adapted for ActinoBase by Jake T. Newitt, PhD student at the University of East Anglia.

Nucleic Acid Methods

2019-08-12T19:49:35Z

J Newitt:

[[ChIP Seq]]

[[Salting out method]]

Nucleic Acid Methods

2019-08-12T19:49:20Z

J Newitt:

[[ChIP Seq]]
[[Salting out method]]

Salting Out Genomic DNA Extraction Method

2019-08-12T19:47:20Z

J Newitt: Created page with "=Isolation of high molecular weight (HMW) genomic DNA by salting out= The salting out method is used to isolate high yields of high molecular weight DNA, usually for applicat..."

=Isolation of high molecular weight (HMW) genomic DNA by salting out=

The salting out method is used to isolate high yields of high molecular weight DNA, usually for applications such as whole genome sequencing. It is particularly useful for long read sequencing such as PacBIO and nanopore, as ''Streptomyces'' has long regions of repeating DNA.

It is recommended that a whole day is allocated for this protocol, particularly if it is the first time conducting it.

==Preparation and reagents needed==
#Mycelium from 25ml culture (split a 50ml culture into 2)
#SET buffer:- 75mM NaCl, 25mM EDTA pH8, 20mM Tris-HCl pH7.5
#Lysozyme:- 50mg ml-1
#Proteinase K:- 20mg ml-1
#SDS:- 10%
#NaCl:- 5M
#Isopropanol
#70% Ethanol
#TE buffer of sterilised dH2O
#Sealed Pateur pipette
#Eppendorf tubes
#10ml pipettes
#Yellow tips/blue tips and P200/P1000 pipette
#5ml or 10ml pipette

'''Instructions'''
#Resuspend mycelium in 5ml SET buffer in a 50ml falcon tube. Add 100µl of lysozyme solution. Incubate at 37 degrees C°
#Add 140µl proteinase K solution and 600µl 10% SDS, then mix by inversion. Incubate at 55° for 2 hours and invert occasionally
#Add 2ml 5M NaCl and mix by inversion
#Allow to temperature to cool to 37° or lower before adding 5ml chloroform. Mix by inversion for 30 minutes at 20°
#Centrifuge at 4500g for 15 minutes at 20°
#Carefully remove the top layer with a cut pipette tip and transfer to a clean tube. If the solution is still opaque, consider adding more NaCl, SDS and Chloroform as per steps 2-4 and repeat step 5
#The solution should be incubated on ice for 2 minutes, before adding 0.6 vol ice cold isopropanol. Mix by inversion and continue to incubate on ice for around 3 minutes. Spool DNA onto a sealed pasteur pipette
#Rinse DNA in 5ml 70% ethanol and leave to air dry. Using cut tips, resuspend in 500µl of TE or sterilised dH2O

==Uses==
*[[whole genome sequencing]]
*[[template generation for PCR]]

==Notes==
For growth in liquid culture, [[DNB]] can be made without the agar.

==References==

ISP2

2019-07-04T16:05:54Z

J Newitt: /* International Streptomyces Project-2 (ISP-2) */

=International Streptomyces Project-2 (ISP-2)=

ISP-2 is a rich medium that is routinely used for cultivating Streptmyces lydicus along with various other plant root associated strains. It contains malt extract and yeast extract, with dextrose as a carbon source; exact composition will vary between batches.

Many ''Streptomyces'' spp. grow well on ISP-2, but developmental and/or antibiotic production phenotypes may differ compared to growth on other media (e.g. [[SFM]]).

==Preparation==
Per Litre:
*4g Yeast extract powder
*10g Malt extract powder
*4g Dextrose
*20g Agar
*1L dH2O

'''Instructions'''
#For solid medium, add 2g of Agar to each flask
#Add the rest of the components to a beaker with the dH2O
#Add 100ml to each flask
#Autoclave

==Uses==
*[[Streptomyces maintenance]]
*[[Spore titres]]
*[[Re-isolation experiments]]
*[[Selection for resistance to salt-sensitive antibiotics]]

==Notes==
For growth in liquid culture, [[ISP-2]] can be made without the agar.

==References==

ISP2

2019-07-04T16:04:56Z

J Newitt: Created page with "=International Streptomyces Project-2 (ISP-2)= ISP-2 is a rich medium that is routinely used for cultivating Streptmyces lydicus along with various other plant root associate..."

=International Streptomyces Project-2 (ISP-2)=

ISP-2 is a rich medium that is routinely used for cultivating Streptmyces lydicus along with various other plant root associated strains. It contains malt extract and yeast extract, with dextrose as a carbon source; exact composition will vary between batches.

Many ''Streptomyces'' spp. grow well on DNA, but developmental and/or antibiotic production phenotypes may differ compared to growth on other media (e.g. [[SFM]]).

==Preparation==
Per Litre:
*4g Yeast extract powder
*10g Malt extract powder
*4g Dextrose
*20g Agar
*1L dH2O

'''Instructions'''
#For solid medium, add 2g of Agar to each flask
#Add the rest of the components to a beaker with the dH2O
#Add 100ml to each flask
#Autoclave

==Uses==
*[[Streptomyces maintenance]]
*[[Spore titres]]
*[[Re-isolation experiments]]
*[[Selection for resistance to salt-sensitive antibiotics]]

==Notes==
For growth in liquid culture, [[ISP-2]] can be made without the agar.

==References==