CRISPR - Revision history

Sam Prudence: Blanked the page

2019-11-07T17:29:04Z

Blanked the page

Show changes

Matth at 09:43, 22 July 2019

2019-07-22T09:43:33Z

Show changes

Matth at 08:55, 22 July 2019

2019-07-22T08:55:33Z

← Older revision		Revision as of 08:55, 22 July 2019
Line 41:		Line 41:


	<em>Designing flanking primers</em>		<strong>Designing flanking primers</strong>

	1. Find gene sequence		1. Find gene sequence

	2. Keep start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC)		2. Keep start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC)

	3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC		3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC

	4. Design ~20NT external flanking primers with 60-70% GC and ~68°C Tm		4. Design ~20NT external flanking primers with 60-70% GC and ~68°C Tm

	5. Insert XbaI and gibson overlap sequence on end (not essential but increases efficiency of Gibson assembly and allows templates to be digested out/cloned back in)		5. Insert XbaI and gibson overlap sequence on end (not essential but increases efficiency of Gibson assembly and allows templates to be digested out/cloned back in)
	Designing gRNA
			<strong>Designing gRNA</strong>

	1. Open new copy of gene sequence		1. Open new copy of gene sequence

	2. Look at REVERSE STRAND		2. Look at REVERSE STRAND

	3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes)		3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes)

	4. Design ~20 NT gRNA with a Tm > 60°C		4. Design ~20 NT gRNA with a Tm > 60°C

	5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against full genome to check gRNA specificity. More important to not have matching on 3’ end		5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against full genome to check gRNA specificity. More important to not have matching on 3’ end

	6. Add BbsI cut site sticky ends for golden gate assembly		6. Add BbsI cut site sticky ends for golden gate assembly
	Anneal gRNA using oligo spacer programme
			<strong>Anneal gRNA using oligo spacer programme</strong>

	1. Mix 5 μl Forward gRNA and 5 μl Reverse gRNA with 90 μl HEPES buffer		1. Mix 5 μl Forward gRNA and 5 μl Reverse gRNA with 90 μl HEPES buffer

	2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme		2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme
	Golden gate assembly of annealed gRNA into pCRISP plasmid
			<strong>Golden gate assembly of annealed gRNA into pCRISP plasmid</strong>

	1. Set up 20 μl reactions with:		1. Set up 20 μl reactions with:
	• 100 ng backbone
			• 100 ng backbone

	• 0.3 μl gRNA		• 0.3 μl gRNA

	• 2 μl T4 ligase buffer (NEB)		• 2 μl T4 ligase buffer (NEB)

	• 1 μl T4 ligase (NEB)		• 1 μl T4 ligase (NEB)

	• 1 μl BbsI (NEB)		• 1 μl BbsI (NEB)

	• dH2O		• dH2O

	2. Incubate using golden gate programme (as below)		2. Incubate using golden gate programme (as below)

	• 10 cycles of the following:		• 10 cycles of the following:

	• 10 minutes at 37°C		• 10 minutes at 37°C

	• 10 minutes at 16°C		• 10 minutes at 16°C

	• 5 minutes at 50°C		• 5 minutes at 50°C

	• 20 minutes at 65°C		• 20 minutes at 65°C

	• 4°C hold		• 4°C hold
	Transform Golden Gate plasmid into E. coli using heat shock
			<strong>Transform Golden Gate plasmid into E. coli using heat shock</strong>

	1. Thaw chemically competent NEB5/Top10 cells on ice		1. Thaw chemically competent NEB5/Top10 cells on ice
	2. Transfer 50 μl of competent cells to a 1.5 ml microcentrifuge tube		2. Transfer 50 μl of competent cells to a 1.5 ml microcentrifuge tube

Matth at 08:53, 22 July 2019

2019-07-22T08:53:01Z

Matth: Created page with "Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2. Written by Rebecca Devine, Matt Hutchings’ Laboratory, University of East Anglia, UK O..."

2019-07-22T08:51:54Z

Created page with "Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2. Written by Rebecca Devine, Matt Hutchings’ Laboratory, University of East Anglia, UK O..."

New page
Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2. Written by
Rebecca Devine, Matt Hutchings’ Laboratory, University of East Anglia, UK

Overview (see following pages for more detail)

1. Design flanking primers and gRNA
2. Optimise primer conditions using gradient PCR on flanking primers using WT gDNA
3. Anneal gRNA using oligo spacer programme
4. Golden gate assembly of annealed gRNA into plasmid
5. Transform into E. coli using heat shock
6. Select for successful transformants using blue/white selection and Xgal
7. Recover plasmid by miniprep
8. Amplify up flanks using gDNA and optimised primer conditions
9. Gel extract flanks
10. Linearize pCRISPomyces-2 vector + gRNA generated above using XbaI digestion
11. Gel purify vector
12. Gibson Assembly of flanks into digested vector
13. Transform into chemically competent E. coli NEB5alpha cells
14. Grow cells on LB + Apr plates to select for transformants
15. Confirm transformation using colony PCR (or XbaI digestion of plasmid prep)
16. Extract plasmid DNA from successful colony(s) by plasmid prep
17. Transform finished construct into ET cells using electroporation
18. Conjugate ET into Streptomyces and antibiotic treat to select for ex-conjugants

Designing flanking primers

1. Find gene sequence
2. Keep start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC)
3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC
4. Design ~20NT external flanking primers with 60-70% GC and ~68°C Tm
5. Insert XbaI and gibson overlap sequence on end (not essential but increases efficiency of Gibson assembly and allows templates to be digested out/cloned back in)
Designing gRNA
1. Open new copy of gene sequence
2. Look at REVERSE STRAND
3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes)
4. Design ~20 NT gRNA with a Tm > 60°C
5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against full genome to check gRNA specificity. More important to not have matching on 3’ end
6. Add BbsI cut site sticky ends for golden gate assembly
Anneal gRNA using oligo spacer programme
1. Mix 5 μl Forward gRNA and 5 μl Reverse gRNA with 90 μl HEPES buffer
2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme
Golden gate assembly of annealed gRNA into pCRISP plasmid
1. Set up 20 μl reactions with:
• 100 ng backbone
• 0.3 μl gRNA
• 2 μl T4 ligase buffer (NEB)
• 1 μl T4 ligase (NEB)
• 1 μl BbsI (NEB)
• dH2O
2. Incubate using golden gate programme (as below)
• 10 cycles of the following:
• 10 minutes at 37°C
• 10 minutes at 16°C
• 5 minutes at 50°C
• 20 minutes at 65°C
• 4°C hold
Transform Golden Gate plasmid into E. coli using heat shock
1. Thaw chemically competent NEB5/Top10 cells on ice
2. Transfer 50 μl of competent cells to a 1.5 ml microcentrifuge tube
3. Add 2 μl assembled vector and mix gently (tip mix, DO NOT VORTEX!!)
4. Incubate on ice for 30 minutes (DO NOT MIX!!)
5. Heat shock cells at 42°C for 30 seconds
6. Transfer tubes on ice for 2 minutes
7. Add 950 μl SOC media and incubate at 37°C for 1 hour at 250 rpm to allow recovery
8. Plate onto pre-warmed LB + Apramycin + X-gal plates and incubate at 37°C overnight
Select for successful transformants using blue/white selection
1. Pick white colonies and grow overnight in 10 ml LB + Apramycin
Extract DNA from successful colony(s) (plasmid prep)
2. Grow up successful colonies in LB at 37°C overnight
3. Recover plasmid using the QIAprep Spin Miniprep kit (Qiagen)
4. Pellet ~3 ml cells by centrifugation
5. Resuspend cells in 250 μl Buffer P1 and 250 μl Buffer P2
6. After 2-3 minutes of lysis reaction add Buffer N3 and centrifuge samples at 13000 rpm for 10 minutes
7. Apply supernatant to a BLUE QIAprep spin column and centrifuge for 30 seconds
8. Wash the column with 0.75 ml Buffer PE
9. Discard the flow through and elute plasmid DNA in 50 μl dH2O
10. Quantify using Nanodrop and take note of concentration for use in golden gate reaction
Linearize gRNA vector using XbaI digestion
1. Incubate or 1 μg vector with 1 μl XbaI, 5 μl buffer H and 40 μl dH2O at 37°C for approximately 2 hours
2. Dephosphorylate with shrimp alkaline phosphatase
3. Run product on a gel against undigested vector and visualise using UV
4. Excise band using a scalpel and extract DNA using the QIAquick gel extraction kit
Gibson Assembly of flanks into digested vector
1. PCR Amplify flanking DNA using Q5 (high fidelity – less errors, good for cloning)
2. Gel purify using Qiagen kit
3. Incubate digested vector with 2x flanks (aim for roughly 3:1 vector:insert) and 10 μl Gibson Assembly master mix (NEB) at 50°C for at least 15 minutes (longer gives better efficiency – I usually leave it for 1 hour)
Transform into chemically competent E. coli using heat shock (see above)
Confirm transformation using colony PCR
1. ******Conduct in STERILE conditions!!******
2. Take ~8 1.5 ml microcentrifuge tubes (less if fewer colonies) and fill with ~500 ml LB
3. Make up Biotaq Red master mix with 1% v/v primer
4. Using a p10 tip, pick colony and touch tip to empty PCR tube before discarding into LB tube
5. Add 10 μl master mix to each PCR tube and amplify (55°C for pCRISP-2 test primers)
6. Run products on gel to see insert
7. Innoculate successful colonies in 10 ml LB (using 500 ml LB plus tip)
Recover plasmid
…..by same method as previously
Transform finished cosmid into ET cells using electroporation
1. Streptomyces strains contain a methyl-sensing restriction system therefore disrupted cosmids must initially be passaged through a non-methylating E. coli strain
2. Thaw ET cells on ice
3. Cool cuvette
4. Take to electroporation machine – set to Bacteria, EC2 (up)
5. Put 1 μl cosmid DNA into 50 μl of electrocompetent ET12567 cells containing the driver plasmid pUZ8002 and “pulse”
6. Take care not to hold the metal parts of the cuvette to warm it up
7. Reading should be around 5.4
8. Add 900 μl LB and pipette tip mix
9. Transfer to microcentrifuge
10. Grow up for 1 hour to recover
11. Plate onto LB agar containing kanamycin, apramycin and chloramphenicol to select for the incoming cosmid
12. Incubate plates at 37ºC overnight
13. Pick colonies, grow overnight in liquid culture and use for conjugation and glycerol stock

Conjugate ET into KY5 and antibiotic treat to select for ex-conjugants
1. Grow E. coli colonies selected from transformation plates in 10 ml LB broth plus Kanamycin, Chloramphenicol and Apramycin at 37°C overnight rotating at 250 rpm
2. Sub-culture E. coli under the same conditions for approximately 4 hours the following day
3. Once sub-cultures have reached OD600 0.6-0.8, wash the cells twice in LB to remove antibiotics that might inhibit the Streptomyces by spinning at 4000 rpm for 5 minutes.
4. Pre-germinate Streptomyces spores in 2YT at 50 C for 10 minutes, leave to cool
5. Combine cells, centrifuge and resuspended in 200 ul LB
6. Plate dilutions of approx. 200 ul onto SFM agar + MgCl2 and incubated at 30°C for 16-20 hours (I increase the time for CRISPR conjugations compared to other vectors e.g. integrative plasmids i.e. use 20 hours rather than 16)
7. Overlay with 1 ml of dH2O + 0.5 mg Nalidixic acid + 1.25 mg Apramycin to selectively kill the E. coli
8. Return plates to the incubator at 30°C for four days or until colonies appeared (Often takes longer for CRISPR ex-conjugants to appear compared to other vectors e.g. integrative plasmids i.e. if normally takes 3-4 days expect to leave plates for 5-6 days AT LEAST!)

← Older revision		Revision as of 08:53, 22 July 2019
Line 2:		Line 2:
	Rebecca Devine, Matt Hutchings’ Laboratory, University of East Anglia, UK		Rebecca Devine, Matt Hutchings’ Laboratory, University of East Anglia, UK

	<em>Overview (see following pages for more detail)</em>		<strong>Overview (see following pages for more detail)</strong>

	1. Design flanking primers and gRNA		1. Design flanking primers and gRNA

	2. Optimise primer conditions using gradient PCR on flanking primers using WT gDNA		2. Optimise primer conditions using gradient PCR on flanking primers using WT gDNA

	3. Anneal gRNA using oligo spacer programme		3. Anneal gRNA using oligo spacer programme

	4. Golden gate assembly of annealed gRNA into plasmid		4. Golden gate assembly of annealed gRNA into plasmid

	5. Transform into E. coli using heat shock		5. Transform into E. coli using heat shock

	6. Select for successful transformants using blue/white selection and Xgal		6. Select for successful transformants using blue/white selection and Xgal

	7. Recover plasmid by miniprep		7. Recover plasmid by miniprep

	8. Amplify up flanks using gDNA and optimised primer conditions		8. Amplify up flanks using gDNA and optimised primer conditions

	9. Gel extract flanks		9. Gel extract flanks

	10. Linearize pCRISPomyces-2 vector + gRNA generated above using XbaI digestion		10. Linearize pCRISPomyces-2 vector + gRNA generated above using XbaI digestion

	11. Gel purify vector		11. Gel purify vector

	12. Gibson Assembly of flanks into digested vector		12. Gibson Assembly of flanks into digested vector
	13. Transform into chemically competent E. coli ~~NEB5alpha~~ cells
			13. Transform into chemically competent E. coli NEB DH5alpha cells

	14. Grow cells on LB + Apr plates to select for transformants		14. Grow cells on LB + Apr plates to select for transformants

	15. Confirm transformation using colony PCR (or XbaI digestion of plasmid prep)		15. Confirm transformation using colony PCR (or XbaI digestion of plasmid prep)

	16. Extract plasmid DNA from successful colony(s) by plasmid prep		16. Extract plasmid DNA from successful colony(s) by plasmid prep

	17. Transform finished construct into ET cells using electroporation		17. Transform finished construct into ET cells using electroporation

	18. Conjugate ET into Streptomyces and antibiotic treat to select for ex-conjugants		18. Conjugate ET into Streptomyces and antibiotic treat to select for ex-conjugants