CUBIC - Revision history

Gilles: /* Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid */

2024-01-23T14:35:52Z

Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid

← Older revision		Revision as of 14:35, 23 January 2024
Line 85:		Line 85:
	7. Hold at 4℃		7. Hold at 4℃

	3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.		3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA. Not doing so is expected to result in a cloning efficiency of gRNA at approximately 90%.

	~~Note1~~: To facilitate the extensive construction of a CRISPRi library, both the quantity of BsaI-HF®v2 and T4 DNA Ligase can be minimized to one-tenth of the original amount.		Note: To facilitate the extensive construction of a CRISPRi library, both the quantity of BsaI-HF®v2 and T4 DNA Ligase can be minimized to one-tenth of the original amount.

	==Transformation of CUBIC plasmids into <em>E. coli</em>==		==Transformation of CUBIC plasmids into <em>E. coli</em>==

Gilles: /* Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid */

2024-01-23T14:28:22Z

Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid

← Older revision		Revision as of 14:28, 23 January 2024
Line 86:		Line 86:

	3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.		3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

			Note1: To facilitate the extensive construction of a CRISPRi library, both the quantity of BsaI-HF®v2 and T4 DNA Ligase can be minimized to one-tenth of the original amount.

	==Transformation of CUBIC plasmids into <em>E. coli</em>==		==Transformation of CUBIC plasmids into <em>E. coli</em>==

Gilles: /* Preparation of double-stranded gRNA oligonucleotides */

2024-01-23T14:27:24Z

Preparation of double-stranded gRNA oligonucleotides

← Older revision		Revision as of 14:27, 23 January 2024
Line 50:		Line 50:

	4. Incubate the reaction at 37℃ for 1 h		4. Incubate the reaction at 37℃ for 1 h

			Note: To facilitate the extensive construction of a CRISPRi library, the quantity of T4 Polynucleotide Kinase can be minimized to one-tenth of the original amount.

	==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==		==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

Gilles at 13:25, 23 January 2024

2024-01-23T13:25:22Z

← Older revision		Revision as of 13:25, 23 January 2024
Line 8:		Line 8:
	[https://www.addgene.org/210387/ pCB-1]		[https://www.addgene.org/210387/ pCB-1]

	[https://www.addgene.org/210388/ ~~PCB~~-2]		[https://www.addgene.org/210388/ pCB-2]

	==Organisms==		==Organisms==

Gilles: /* CUBIC */

2024-01-23T13:21:21Z

CUBIC

← Older revision		Revision as of 13:21, 23 January 2024
Line 1:		Line 1:
	=CUBIC=		=CUBIC=
	CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.		CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in <em>Streptomyces</em>.

	Click the link to find out more:		Click the link to find out more:

	CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces		[https://pubs.acs.org/doi/10.1021/acssynbio.3c00464 CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in <em>Streptomyces</em>]

	pCB-1		[https://www.addgene.org/210387/ pCB-1]

	PCB-2		[https://www.addgene.org/210388/ PCB-2]

	==Organisms==		==Organisms==
Line 41:		Line 41:
	3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:		3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

	• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)		• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

	• 1 μl T4 Polynucleotide Kinase (NEB)		• 1 μl T4 Polynucleotide Kinase (NEB)

	• 3 μl 100 nM phosphorylated gRNA oligonucleotides		• 3 μl 100 nM phosphorylated gRNA oligonucleotides

	• 5 μl ddH2O		• 5 μl ddH2O

	4. Incubate the reaction at 37℃ for 1 h		4. Incubate the reaction at 37℃ for 1 h
Line 55:		Line 55:
	1. Set up 10 μl reaction with:		1. Set up 10 μl reaction with:

	• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)		• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

	• 1.3 μl phosphorylated ds gRNA oligonucleotides		• 1.3 μl phosphorylated ds gRNA oligonucleotides

	• 1 μl 10 ×T4 ligase buffer (NEB)		• 1 μl 10 ×T4 ligase buffer (NEB)

	• 1 μl BsaI-HF®v2 (NEB)		• 1 μl BsaI-HF®v2 (NEB)

	• 0.5 μl T4 DNA Ligase		• 0.5 μl T4 DNA Ligase

	• 5.2 μl ddH2O		• 5.2 μl ddH2O

	2. Incubate the reaction using the following program in a thermal cycler:		2. Incubate the reaction using the following program in a thermal cycler:

	1. 5 min at 37℃		1. 5 min at 37℃

	2. 10 min at 16℃		2. 10 min at 16℃

	3. Go to step 1, 9 times		3. Go to step 1, 9 times

	4. 1 cycle of 15 min at 37℃		4. 1 cycle of 15 min at 37℃

	5. 1 cycle of 5 min at 50℃		5. 1 cycle of 5 min at 50℃

	6. 1 cycle of 5 min at 80℃		6. 1 cycle of 5 min at 80℃

	7. Hold at 4℃		7. Hold at 4℃

	3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.		3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

	==Transformation of CUBIC plasmids into E. coli==		==Transformation of CUBIC plasmids into <em>E. coli</em>==

	1. Thaw chemically competent DH5a cells on ice		1. Thaw chemically competent DH5a cells on ice
Line 107:		Line 107:
	2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit		2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

	==Transformation of CUBIC plasmids into non-methylating E. coli==		==Transformation of CUBIC plasmids into non-methylating <em>E. coli</em>==

	1. Thaw chemically competent ET12567 cells on ice		1. Thaw chemically competent ET12567 cells on ice

	2. Add 2 μl CUBIC plasmid to 20 μl competent cells		2. Add 2 μl CUBIC plasmid to 20 μl competent cells

	3. Incubate on ice for 30 min		3. Incubate on ice for 30 min
Line 123:		Line 123:
	7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight		7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

	==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==		==Tri-parental conjugation into <em>Streptomyces</em> and antibiotic treatment to select for ex-conjugants==

	1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm		1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm
Line 131:		Line 131:
	3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB		3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

	4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool		4. While washing the </em>E. coli</em> cells, pre-geminate <em>Streptomyces</em> spores in 2×YT at 50℃ for 10 min, leave to cool

	5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h		5. Combine <em>E. coli</em> and <em>Streptomyces</em> and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

	6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days		6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

Gilles: Created page with "=CUBIC= CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces. Click the link to find out more: CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces pCB-1 PCB-2 ==Organisms== CUBIC has been confirmed to work for the following species: **Streptomyces coelicolor* **Streptomyces lividans* **Streptomyces venezuelae* **Streptomyc..."*

2024-01-22T21:09:39Z

Created page with "=CUBIC= CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces. Click the link to find out more: CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces pCB-1 PCB-2 ==Organisms== CUBIC has been confirmed to work for the following species: *Streptomyces coelicolor *Streptomyces lividans *Streptomyces venezuelae *Streptomyc..."

New page
=CUBIC=
CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces

pCB-1

PCB-2

==Organisms==

CUBIC has been confirmed to work for the following species:

*[[Streptomyces coelicolor]]
*[[Streptomyces lividans]]
*[[Streptomyces venezuelae]]
*[[Streptomyces avermitillis]]
*[[Streptomyces roseosporus]]
*[[Streptomyces roseifaciens]]

==gRNA design using Geneious Prime==

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

==Preparation of double-stranded gRNA oligonucleotides==

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

==Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid==

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

==Transformation of CUBIC plasmids into E. coli==

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Select for correct colony and plasmid mini-prep==

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

==Transformation of CUBIC plasmids into non-methylating E. coli==

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

==Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants==

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.