CRISPR/Cas9-mediated genome editing: Difference between revisions
Sam Prudence (talk | contribs) |
Sam Prudence (talk | contribs) |
||
(10 intermediate revisions by the same user not shown) | |||
Line 21: | Line 21: | ||
1. Design flanking primers and gRNA | 1. Design flanking primers and gRNA | ||
2. Optimise primer conditions using gradient PCR on flanking primers using WT gDNA | 2. Optimise primer conditions using gradient PCR on flanking primers using WT genomic DNA (gDNA) | ||
3. Anneal gRNA using oligo spacer programme | 3. Anneal guide RNA oligos (gRNA) oligos using oligo spacer programme | ||
4. Golden gate assembly of annealed gRNA into plasmid | 4. Golden gate assembly of annealed gRNA into plasmid | ||
5. Transform into ''E. coli'' using heat shock | 5. Transform vector into ''E. coli'' using heat shock | ||
6. Select for successful transformants using blue/white | 6. Select for successful transformants using blue/white screening to select successful insertion of the gRNA into the vector | ||
7. Recover plasmid by miniprep | 7. Recover plasmid by miniprep | ||
Line 57: | Line 57: | ||
==Designing flanking primers== | ==Designing flanking primers== | ||
1. Find gene | 1. Find the sequence for your target gene | ||
2. Keep start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC) | 2. Keep the start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), and delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC) | ||
3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC | 3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC | ||
Line 69: | Line 69: | ||
==Designing gRNA== | ==Designing gRNA== | ||
1. Open new copy of gene sequence | 1. Open a new (unedited) copy of the target gene sequence | ||
2. Look at REVERSE STRAND | 2. Look at the REVERSE STRAND | ||
3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes) | 3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes) | ||
Line 77: | Line 77: | ||
4. Design ~20 NT gRNA with a Tm > 60°C | 4. Design ~20 NT gRNA with a Tm > 60°C | ||
5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against full genome to check gRNA specificity. | 5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against the full genome to check gRNA specificity. It is more important to not have matching sequences on the 3’ end | ||
6. Add BbsI cut site sticky ends for golden gate assembly | 6. Add BbsI cut site sticky ends for golden gate assembly | ||
The website [https://crispy.secondarymetabolites.org/#/input CRISPY-web] can also be used to gRNA design, simply upload your target genome and define a target region. The software will then provide a list the most unique PAM sequences & gRNAs it can find within the target region. | |||
==Anneal gRNA using oligo spacer programme== | ==Anneal gRNA using oligo spacer programme== | ||
1. Mix 5 μl Forward gRNA and 5 μl Reverse gRNA with 90 μl HEPES buffer | 1. Mix 5 μl 100μM Forward gRNA and 5 μl 100μM Reverse gRNA oligo with 90 μl HEPES buffer | ||
2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme | 2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme | ||
Line 137: | Line 139: | ||
==Select for successful transformants using blue/white selection== | ==Select for successful transformants using blue/white selection== | ||
Golden gate cloning into [[pCRISPomyces-2]] uses blue white screening to select for successful transformants (See AddGene blog [https://blog.addgene.org/plasmids-101-blue-white-screening here] for an explaination of blue-white screening). Pick white colonies and grow overnight in 10 ml [[LB]] + Apramycin then extract plasmid DNA from successful colony(s). | |||
2. Grow up successful colonies in [[LB]] at 37°C overnight | 2. Grow up successful (white) colonies in [[LB]] at 37°C overnight | ||
3. Recover plasmid using the QIAprep Spin Miniprep kit (Qiagen) | 3. Recover plasmid using the QIAprep Spin Miniprep kit (Qiagen) (or a plasmid miniprep kit of choice) | ||
4. Pellet ~3 ml cells by centrifugation | 4. Pellet ~3 ml cells by centrifugation | ||
Line 155: | Line 157: | ||
9. Discard the flow through and elute plasmid DNA in 50 μl dH2O | 9. Discard the flow through and elute plasmid DNA in 50 μl dH2O | ||
10. Quantify using Nanodrop and take note of concentration for use in | 10. Quantify using Nanodrop and take note of concentration for use in the next steps | ||
==Linearize gRNA vector using XbaI digestion== | ==Linearize gRNA vector using XbaI digestion== | ||
Line 195: | Line 197: | ||
7. Recover plasmid by same method as previously | 7. Recover plasmid by same method as previously | ||
==Transform finished | ==Transform finished plasmid into ET cells using electroporation== | ||
1. Streptomyces strains contain a methyl-sensing restriction system therefore disrupted cosmids must initially be passaged through a non-methylating ''E. coli'' strain | 1. Streptomyces strains contain a methyl-sensing restriction system therefore disrupted cosmids must initially be passaged through a non-methylating ''E. coli'' strain | ||
2. Thaw ET cells on ice | 2. Thaw ET cells on ice | ||
3. Cool cuvette | 3. Cool cuvette on ice | ||
4. Electropotate using appropriate settings using 1 μl cosmid DNA in 50 μl of electrocompetent ET12567 cells containing the driver plasmid [[pUZ8002]] and “pulse” | |||
5. Take care not to hold the metal parts of the cuvette to warm it up | |||
6. Reading should be around 5.4 | |||
7. Add 900 μl [[LB]] and pipette tip mix | |||
8. Transfer to eppendorf & grow at 37ºC up for 1 hour to recover | |||
11. Plate onto [[LB]] agar containing kanamycin, apramycin and chloramphenicol to select for the incoming | 11. Plate onto [[LB]] agar containing kanamycin, apramycin and chloramphenicol to select for the incoming plasmid | ||
12. Incubate plates at 37ºC overnight | 12. Incubate plates at 37ºC overnight | ||
Line 234: | Line 232: | ||
4. Pre-germinate Streptomyces spores in [[2X YT]] at 50°C for 10 minutes, leave to cool | 4. Pre-germinate Streptomyces spores in [[2X YT]] at 50°C for 10 minutes, leave to cool | ||
5. Combine cells, centrifuge and resuspended in 200 | 5. Combine cells, centrifuge and resuspended in 200 μl [[LB]] | ||
6. Plate dilutions of approx. 200 | 6. Plate dilutions of approx. 200 μl onto [[SFM]] agar + MgCl2 and incubated at 30°C for 16-20 hours (I increase the time for CRISPR conjugations compared to other vectors e.g. integrative plasmids i.e. use 20 hours rather than 16) | ||
7. Overlay with 1 ml of dH2O + 0.5 mg Nalidixic acid + 1.25 mg Apramycin to selectively kill the ''E. coli'' | 7. Overlay with 1 ml of dH2O + 0.5 mg Nalidixic acid + 1.25 mg Apramycin to selectively kill the ''E. coli'' |
Revision as of 16:52, 14 November 2019
CRISPR/Cas9 Genome editing
CRISPR/Cas9 genome editing can be used for precise CRISPR/Cas9-mediated genome engineering of Streptomyces strains. Mutations made have ranged from 1-100kbp deletions, precise codon changes to alter amino acids and insertions to add Flag-tags to proteins encoded at their native loci. Several different plasmids have been constructed and published and are listed below. Click the links to find out more.
For a comprahensive guide for CRISPR/Cas knockouts in Streptomyces using pCRISPomyces-2 see the link below to the 'Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2', written by Dr. Rebecca Devine.
Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2
Organisms
This protocol has been confrimed to work for the following-
Workflow Overview
1. Design flanking primers and gRNA
2. Optimise primer conditions using gradient PCR on flanking primers using WT genomic DNA (gDNA)
3. Anneal guide RNA oligos (gRNA) oligos using oligo spacer programme
4. Golden gate assembly of annealed gRNA into plasmid
5. Transform vector into E. coli using heat shock
6. Select for successful transformants using blue/white screening to select successful insertion of the gRNA into the vector
7. Recover plasmid by miniprep
8. Amplify up flanks using gDNA and optimised primer conditions
9. Gel extract flanks
10. Linearize pCRISPomyces-2 vector + gRNA generated above using XbaI digestion
11. Gel purify vector
12. Gibson Assembly of flanks into digested vector
13. Transform into chemically competent E. coli NEB DH5alpha cells
14. Grow cells on LB + Apr plates to select for transformants
15. Confirm transformation using colony PCR (or XbaI digestion of plasmid prep)
16. Extract plasmid DNA from successful colony(s) by plasmid prep
17. Transform finished construct into ET cells using electroporation
18. Conjugate ET into Streptomyces and antibiotic treat to select for ex-conjugants
Designing flanking primers
1. Find the sequence for your target gene
2. Keep the start (ATG/GTG) and stop (TGA) codon (to keep the deletion in frame), and delete KO region and insert linker sequence (GCGAGCTCGCCTGGTCGCAGCAGC)
3. Go back ~20NT to generate internal primers with similar Tm to help annealing and ~70% GC
4. Design ~20NT external flanking primers with 60-70% GC and ~68°C Tm
5. Insert XbaI and gibson overlap sequence on end (not essential but increases efficiency of Gibson assembly and allows templates to be digested out/cloned back in)
Designing gRNA
1. Open a new (unedited) copy of the target gene sequence
2. Look at the REVERSE STRAND
3. Find NGG (PAM) within gene to be removed (search for ANGG or better TANGG to find unique sequences in high GC genomes)
4. Design ~20 NT gRNA with a Tm > 60°C
5. Blast ALL 4 POSSIBLE gRNAs (I.E where N is either A,C,T, or G) against the full genome to check gRNA specificity. It is more important to not have matching sequences on the 3’ end
6. Add BbsI cut site sticky ends for golden gate assembly
The website CRISPY-web can also be used to gRNA design, simply upload your target genome and define a target region. The software will then provide a list the most unique PAM sequences & gRNAs it can find within the target region.
Anneal gRNA using oligo spacer programme
1. Mix 5 μl 100μM Forward gRNA and 5 μl 100μM Reverse gRNA oligo with 90 μl HEPES buffer
2. Heat to 95°C in a thermocycler and then ramping down to 4°C at 0.1°C per second using spacer oligos programme
Golden gate assembly of annealed gRNA into pCRISPomyces-2
1. Set up 20 μl reactions with:
• 100 ng backbone
• 0.3 μl gRNA
• 2 μl T4 ligase buffer (NEB)
• 1 μl T4 ligase (NEB)
• 1 μl BbsI (NEB)
• dH2O
2. Incubate using golden gate programme (as below)
• 10 cycles of the following:
• 10 minutes at 37°C
• 10 minutes at 16°C
• 5 minutes at 50°C
• 20 minutes at 65°C
• 4°C hold
Transform Golden Gate plasmid into E. coli using heat shock
1. Thaw chemically competent NEB5/Top10 cells on ice
2. Transfer 50 μl of competent cells to a 1.5 ml microcentrifuge tube
3. Add 2 μl assembled vector and mix gently (tip mix, DO NOT VORTEX!!)
4. Incubate on ice for 30 minutes (DO NOT MIX!!)
5. Heat shock cells at 42°C for 30 seconds
6. Transfer tubes on ice for 2 minutes
7. Add 950 μl SOC media and incubate at 37°C for 1 hour at 250 rpm to allow recovery
8. Plate onto pre-warmed LB + Apramycin + X-gal plates and incubate at 37°C overnight
Select for successful transformants using blue/white selection
Golden gate cloning into pCRISPomyces-2 uses blue white screening to select for successful transformants (See AddGene blog here for an explaination of blue-white screening). Pick white colonies and grow overnight in 10 ml LB + Apramycin then extract plasmid DNA from successful colony(s).
2. Grow up successful (white) colonies in LB at 37°C overnight
3. Recover plasmid using the QIAprep Spin Miniprep kit (Qiagen) (or a plasmid miniprep kit of choice)
4. Pellet ~3 ml cells by centrifugation
5. Resuspend cells in 250 μl Buffer P1 and 250 μl Buffer P2
6. After 2-3 minutes of lysis reaction add Buffer N3 and centrifuge samples at 13000 rpm for 10 minutes
7. Apply supernatant to a BLUE QIAprep spin column and centrifuge for 30 seconds
8. Wash the column with 750 µl Buffer PE
9. Discard the flow through and elute plasmid DNA in 50 μl dH2O
10. Quantify using Nanodrop and take note of concentration for use in the next steps
Linearize gRNA vector using XbaI digestion
1. Incubate or 1 μg vector with 1 μl XbaI, 5 μl buffer H and 40 μl dH2O at 37°C for approximately 2 hours
2. Dephosphorylate with shrimp alkaline phosphatase
3. Run product on a gel against undigested vector and visualise using UV
4. Excise band using a scalpel and extract DNA using the QIAquick gel extraction kit
Gibson Assembly of flanks into digested vector
1. PCR Amplify flanking DNA using Q5 (high fidelity – less errors, good for cloning) (Note: See High GC PCR for tips on how to perform PCR amplifications off of high GC genomes such as Streptomyces.)
2. Gel purify using Qiagen kit
3. Incubate digested vector with 2x flanks (aim for roughly 3:1 vector:insert) and 10 μl Gibson Assembly master mix (NEB) at 50°C for at least 15 minutes (longer gives better efficiency – I usually leave it for 1 hour)
4. Transform into chemically competent E. coli using heat shock (see above)
Confirm transformation using colony PCR
Conduct under STERILE conditions!!
1. Take ~8 1.5 ml microcentrifuge tubes (less if fewer colonies) and fill with ~500 µl LB
2. Make up Biotaq Red master mix with 1% v/v primer
3. Using a p10 tip, pick colony and touch tip to empty PCR tube before discarding into LB tube
4. Add 10 μl master mix to each PCR tube and amplify (55°C for pCRISP-2 test primers)
5. Run products on gel to see insert
6. Innoculate successful colonies in 10 ml LB (using the 500 µl LB plus tip)
7. Recover plasmid by same method as previously
Transform finished plasmid into ET cells using electroporation
1. Streptomyces strains contain a methyl-sensing restriction system therefore disrupted cosmids must initially be passaged through a non-methylating E. coli strain
2. Thaw ET cells on ice
3. Cool cuvette on ice
4. Electropotate using appropriate settings using 1 μl cosmid DNA in 50 μl of electrocompetent ET12567 cells containing the driver plasmid pUZ8002 and “pulse”
5. Take care not to hold the metal parts of the cuvette to warm it up
6. Reading should be around 5.4
7. Add 900 μl LB and pipette tip mix
8. Transfer to eppendorf & grow at 37ºC up for 1 hour to recover
11. Plate onto LB agar containing kanamycin, apramycin and chloramphenicol to select for the incoming plasmid
12. Incubate plates at 37ºC overnight
13. Pick colonies, grow overnight in liquid culture and use for conjugation and glycerol stock
Conjugate ET into Streptomyces treat with antibiotics to select for ex-conjugants
Also see Conjugation using ET12567/pUZ8002
1. Grow E. coli colonies selected from transformation plates in 10 ml LB broth plus Kanamycin, Chloramphenicol and Apramycin at 37°C overnight rotating at 250 rpm
2. Sub-culture E. coli under the same conditions for approximately 4 hours the following day
3. Once sub-cultures have reached OD600 0.6-0.8, wash the cells twice in LB to remove antibiotics that might inhibit the Streptomyces by spinning at 4000 rpm for 5 minutes.
4. Pre-germinate Streptomyces spores in 2X YT at 50°C for 10 minutes, leave to cool
5. Combine cells, centrifuge and resuspended in 200 μl LB
6. Plate dilutions of approx. 200 μl onto SFM agar + MgCl2 and incubated at 30°C for 16-20 hours (I increase the time for CRISPR conjugations compared to other vectors e.g. integrative plasmids i.e. use 20 hours rather than 16)
7. Overlay with 1 ml of dH2O + 0.5 mg Nalidixic acid + 1.25 mg Apramycin to selectively kill the E. coli
8. Return plates to the incubator at 30°C for four days or until colonies appeared (Often takes longer for CRISPR ex-conjugants to appear compared to other vectors e.g. integrative plasmids i.e. if normally takes 3-4 days expect to leave plates for 5-6 days AT LEAST!)
Protocol developed & written by Dr. Rebecca Devine, University of East Anglia, adapted for ActinoBase from Hutchings Lab protocol for generating CRISPR/Cas Knockouts using pCRISPomyces-2.