RRNA depletion with Streptomyces coelicolor A3(2) specific probes: Difference between revisions

From ActinoBase
Line 9: Line 9:
Depletion using the NEBNext RNA Depletion Core Reagent Set with RNA Sample Purification Beads (https://www.neb.com/en-gb/products/e7870-nebnext-rna-depletion-core-reagent-set-with-rna-sample-purification-beads#Product%20Information) and custom DNA probes designed for <em>S. coelicolor</em> is more effective than the QIAseq FastSelect 5S/16S/23S kit (Qiagen #335927); NEBNext rRNA Depletion Kit (Bacteria) (NEB #E7850); Illumina Ribo-zero rRNA Removal Kit (Bacteria) (Illumina #MRZMB12424, discontinued). The Illumina kit tested was subsequently replaced by the Illumina Ribo-Zero Plus rRNA Depletion Kit (Illumina #20040526). Additionally three abundant non-mRNA RNAs can be depleted (Table 1).
Depletion using the NEBNext RNA Depletion Core Reagent Set with RNA Sample Purification Beads (https://www.neb.com/en-gb/products/e7870-nebnext-rna-depletion-core-reagent-set-with-rna-sample-purification-beads#Product%20Information) and custom DNA probes designed for <em>S. coelicolor</em> is more effective than the QIAseq FastSelect 5S/16S/23S kit (Qiagen #335927); NEBNext rRNA Depletion Kit (Bacteria) (NEB #E7850); Illumina Ribo-zero rRNA Removal Kit (Bacteria) (Illumina #MRZMB12424, discontinued). The Illumina kit tested was subsequently replaced by the Illumina Ribo-Zero Plus rRNA Depletion Kit (Illumina #20040526). Additionally three abundant non-mRNA RNAs can be depleted (Table 1).


Table 1. Abundant non-mRNA RNAs in <em>S. coelicolor</em>.
'''Table 1.''' Abundant non-mRNA RNAs in <em>S. coelicolor</em>.


[[File: rRNA_depletion_table_1.png]]
[[File: rRNA_depletion_table_1.png]]

Revision as of 16:08, 1 November 2023

Organisms

This protocol has been tested with Streptomyces coelicolor A3(2) MT1110

Description

rRNA depletion using commercial kits targeting generic bacterial sequences is not 100% efficient in the High GC organism S. coelicolor.

Depletion using the NEBNext RNA Depletion Core Reagent Set with RNA Sample Purification Beads (https://www.neb.com/en-gb/products/e7870-nebnext-rna-depletion-core-reagent-set-with-rna-sample-purification-beads#Product%20Information) and custom DNA probes designed for S. coelicolor is more effective than the QIAseq FastSelect 5S/16S/23S kit (Qiagen #335927); NEBNext rRNA Depletion Kit (Bacteria) (NEB #E7850); Illumina Ribo-zero rRNA Removal Kit (Bacteria) (Illumina #MRZMB12424, discontinued). The Illumina kit tested was subsequently replaced by the Illumina Ribo-Zero Plus rRNA Depletion Kit (Illumina #20040526). Additionally three abundant non-mRNA RNAs can be depleted (Table 1).

Table 1. Abundant non-mRNA RNAs in S. coelicolor.

RRNA depletion table 1.png

Materials

Single stranded DNA probes (Table 2) at 2µM concentration in IDTE pH 7.5 (10mM Tris-HCl / 0.1mM EDTA). Integrated DNA Technologies can produce these from their 25nmole DNA oligo pool product. Probes are listed in Table 2 in the Notes section below.

NEBNext RNA Depletion Core Reagent Set with RNA Sample Purification Beads (https://www.neb.com/en-gb/products/e7870-nebnext-rna-depletion-core-reagent-set-with-rna-sample-purification-beads#Product%20Information).

Protocols

As per manufacturer’s instructions.

Notes

The following histograms illustrate effectiveness of rRNA depletion using various methods. Histograms show percentage of bases aligned to NCBI reference sequence NC_003888.3 using Hisat2 program classified as follows - Coding = RNA aligned to coding sequences; Transcribed not translated = RNA aligned to rRNA, tRNA and sRNA; Intergenic = RNA aligned to 5' or 3' UTRs or between annotated sequences.

QIAseq FastSelect 5S/16S/23S kit

PanelA.png

NEBNext rRNA Depletion Kit (Bacteria)

PanelB.png

Illumina Ribo-zero rRNA Removal Kit (Bacteria)

PanelC.png

rRNA depletion with S. coelicolor specific probes

PanelD.png

Table 2 - List of probes

Sequence Target
CAAGTCCTTGCGCGACGCTCCCACGGCTTGTAGGCACACGGTTTCAGGTACTATTT rRNA
CAGTCACGACGCAAGGACAAGTCCTTGCGCGACGCTCCCAC rRNA