Site-specific phage recombinase: Difference between revisions
From ActinoBase
(Created page with "<strong>Integration sites</strong> You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid: *ΦBT1, attB...") |
(No difference)
|
Revision as of 15:16, 17 October 2019
Integration sites You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:
- ΦBT1, attB
GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG
- ΦC31, attB
CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC
- ΦJoe
ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG
