Site-specific phage recombinase

From ActinoBase
Revision as of 15:16, 17 October 2019 by Alicia (talk | contribs) (Created page with "<strong>Integration sites</strong> You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid: *ΦBT1, attB...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Integration sites You can check the sequence of your organism to see if it contains the appropriate integration site for your chosen plasmid:

  • ΦBT1, attB

GCCCGCTGCCGTCCTTGACCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTCCACACCCCGAACGCGAG

  • ΦC31, attB

CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACC

  • ΦJoe

ATCTGGATGTGGGTGTCCATCTGCGGGCAGACGCCGCAGTCGAAGCACGG

Retrieved from ‘https://actinobase.org/index.php?title=Site-specific_phage_recombinase&oldid=1460’