CUBIC

CUBIC

CUBC is a cumate-based inducible CRISPR interference (CRISPRi) system that allows efficient and inducible gene knockdown in Streptomyces.

Click the link to find out more:

CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces

pCB-1

PCB-2

Organisms

CUBIC has been confirmed to work for the following species:

• Streptomyces coelicolor
• Streptomyces lividans
• Streptomyces venezuelae
• Streptomyces avermitillis
• Streptomyces roseosporus
• Streptomyces roseifaciens

gRNA design using Geneious Prime

1. Import the DNA sequence of the target gene and/or genome into Geneious software

2. Specify the target DNA sequence or region for gRNA design

3. Geneious will provide a list of potential gRNA candidates, only choose gRNAs on non-template strand

4. Evaluate the candidate based on specificity and potential off-target effect

5. Select suitable gRNA for further experimental validation

Preparation of double-stranded gRNA oligonucleotides

1. Mix 10 μl 10 μM forward gRNA and 10 μl 10 μM reverse oligo with 80 μl ddH2O

2. Heat to 95℃ in a thermocycler and then ramping down to 4℃ at 0.1℃ per second

3. The double-stranded gRNA oligonucleotides were diluted to 100 nM for phosphorylation in 10 μl reaction volume containing:

• 1 μl 10 ×T4 DNA Ligase Reaction Buffer (NEB)

• 1 μl T4 Polynucleotide Kinase (NEB)

• 3 μl 100 nM phosphorylated gRNA oligonucleotides

• 5 μl ddH2O

4. Incubate the reaction at 37℃ for 1 h

Golden gate assembly of annealed gRNA plasmid into CUBIC plasmid

1. Set up 10 μl reaction with:

• 1 μl pCB-1 or pCB-2 plasmid (10 fmol/μl)

• 1.3 μl phosphorylated ds gRNA oligonucleotides

• 1 μl 10 ×T4 ligase buffer (NEB)

• 1 μl BsaI-HF®v2 (NEB)

• 0.5 μl T4 DNA Ligase

• 5.2 μl ddH2O

2. Incubate the reaction using the following program in a thermal cycler:

1. 5 min at 37℃

2. 10 min at 16℃

3. Go to step 1, 9 times

4. 1 cycle of 15 min at 37℃

5. 1 cycle of 5 min at 50℃

6. 1 cycle of 5 min at 80℃

7. Hold at 4℃

3. (Optional) Treat the reaction with T5 exonuclease (5 units, NEB) or Plasmid-Safe ATP-Dependent DNase (10 units, LGC Biosearch Technologies) at 37℃ for 1 h. This step is used to digest all non-circularized DNA.

Transformation of CUBIC plasmids into E. coli

1. Thaw chemically competent DH5a cells on ice

2. Add 2 μl assembled CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

Select for correct colony and plasmid mini-prep

1. Pick white colonies for colony PCR using primers (Check-f: aaccgcttcgtcgtggagga and Check-r: cttcttgatcgagtgccggt)

2. Isolate CUBIC plasmid DNA from the correct colonies using plasmid mini-prep kit

Transformation of CUBIC plasmids into non-methylating E. coli

1. Thaw chemically competent ET12567 cells on ice

2. Add 2 μl CUBIC plasmid to 20 μl competent cells

3. Incubate on ice for 30 min

4. Heat shock cells at 42℃ for 60 sec

5. Incubate on ice for 5 min

6. Add 200 μl LB media and incubate at 37℃ for 1 hour

7. Plate on pre-warmed LB plates with appropriate antibiotic (Hygromycin for pCB-1 and Apramycin for pCB-2) and incubate at 37℃ overnight

Tri-parental conjugation into Streptomyces and antibiotic treatment to select for ex-conjugants

1. Grow ET12567 (Cm+) harboring CUBIC plasmids and ET12567/pUB307 (Cm+Kan+) in 5 ml LB broth plus appropriate antibiotics at 37℃ overnight rotating at 250 rpm

2. Dilute the overnight culture 1:100 in fresh LB plus antibiotic selection and grow at 37℃ to an OD600 of 0.4-0.6

3. Wash the cells twice to remove antibiotics and resuspend in 0.1 volume of LB

4. While washing the E. coli cells, pre-geminate Streptomyces spores in 2×YT at 50℃ for 10 min, leave to cool

5. Combine E. coli and Streptomyces and plate onto SFM agar + MgCl2 and incubated at 30℃ for 16-20 h

6. Overlay the plate with 1 ml water containing 0.5 mg nalidixic acid and the appropriate plasmid selection (1.25 mg apramycin or 1.25 mg hygromycin), continue incubation at 30℃ for 3 -4 days

7. Pick off exconjugants to SFM plate containing nalidixic acid and antibiotics

8. Make spore stock of exconjugants to facilitate further experimental validation

Protocol developed and written by Chaoxian Bai, Leiden University.